%PDF-1.3 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf CEFR_AW 2020-06-24T14:21:36+07:00 2020-06-24T14:21:36+07:00 2020-06-24T14:21:36+08:00 Adobe Illustrator 24.0 (Windows) 256 216 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgA2AEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9Q3l1PbhTFZzXfKtRCYR xp4+rJF19sVQloXgu9QZIJZvXnWR6ekoU/V4k4/FJvsla0xVFfW5/wDlim++H/qpirvrc/8AyxTf fD/1UxV31uf/AJYpvvh/6qYq763P/wAsU33w/wDVTFXfW5/+WKb74f8Aqpirvrc//LFN98P/AFUx V31uf/lim++H/qpiqAh1SaKFIiocxqFLMTU0FKnMQ6k9zPhX/pmX/fa/ecH5k9y8Lv0zL/vtfvOP 5k9y8Lv0zL/vtfvOP5k9y8Lv0zL/AL7X7zj+ZPcvC79My/77X7zj+ZPcvC79My/77X7zj+ZPcvCh 769e7hWJlChZYZqjxglWUD6SlMfzJ7l4Uzsrye4LCS0lt1UArJIYir17r6bu3/BAZlxNhiUVhQ7F XYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqk+pLqDWepDT24XPrxkHkEPAJEXAY1CkpXfMbV8fhng2 Py267+5ydIYDIOP6f2bfaxX67qJuDGHuAAoZlOprQbjpKVCGtGFK1zRyzSERMy9B2/vhz9/J3I8K +Hbi/wCFH7k50TVnshdvql0BAfTNtAZvrkygj4iWjFSGqCKdMzeztUDMxMwSaIHEJH5uDr8caBiO +zw8I8tk8/TekUJ+uRUBoTyGxP8AtZk/yppufiR+bh/lMv8ANKCvvMkKLWxeCdkcCQTSmFSCvL92 /Fwx3Fcsya/BAAynECXLfmxjp8kiQInZBWPmXW5YVF5baXbXBQlhHqXrIJOYVVr6EbUKVYmmx23r URHaWm/1WH+mj+tP5bL/ADZfIphHfeZZYZnTT7UEKGtv9LZlkNGqrMsPwCqqA1G+10+HfMjIEWDY aSCNiidHn1ie1L6tZw2VzyoIoJzcJx4qa8zHD0Ysv2dwK7VoChKG+0fnmrLavt4GnlEa0BPc+2Sh HiNKSiZtNWBPUmuI4oxsXc8Rv7nLZYK3JCxuRoC2zpgCqxuIwrCqtXYj2xOGuoXfuWtYRKAWuogD sCSB/HEYb6hTfctNrbAVN7CAelWH9cfA8wiz3Kh0qQxeokiuCOS06EddjhOnNc0cSBzHZMjt/wC4 j/1V/VmyhyDWV+SQ7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqxnza90nl3XHtm4yJIjEheZ4iO LlRaippmt7Xjxacg8iY3vW3EOvd3+TlaM1kB67/c+dFs/ML6gJINd1qGO0dFjiuIJDHIEZjTeReY NCrcvjIWpJBBOp4dOYcJx4d75Ebf7Hbo5l5Lvin8v2si8/z676kcMcuoQRJZxG7n0qBzI7mKv7ki cFDzTjujfaG+xIwez8eAeqsZJquOQsDhjz9Pd8Pm36iU+VyH9UeZ80bp8eu6x5OvoLe8udLv/rap De3EJWUBCx/u2llBBX4a1oftADbMXUzwafJxShCcPT6Y0R/H/RH623HGeSNAkHfc8+nmgbbRPNF7 cI1xqV7bLaXQkijekaSwow+F/SnlZgy8qfZ91GS1Gv0kIbQxysVtuRz74Ac/wUY8GUn6pDfr1+1m mci7Zl3kpL9owyXEn1ZJWE0DhPS4lDT0zTny5cSd6Z6D7LknD6TKhI2Dy+HXu8nR9qmF7gcVbHe+ fXpXNl2dW6RjTkAsTsBWpzVltQmleafLb6rFbRatZyXJbj6C3ERkq2wHENXvluLaQWQNJX5rtItc /MfS9D1AO2mJatOYQxUM5EhJqKH9gDbMbVRGXUxhL6a/W9B2fkODQzyw+viq/l+tAXWkLpunaVp7 XK6vbx38yxxQNyIjYxn6vUHZtz08c0/aWERjiif3g4zsP830+9yceo8Wc514cjAc+/f1e79SH862 OnQw+XeGlTQwT3khuNOrI00g5RKVWp5VdRQUzZYcMIQjwwMLO8TduqnlnKcrmJUOe1Md83WPlq01 7y88mh3cOlTQzz3mkn1TcnizITRnDjaMN9ofDvmVKMQRsQO5phKRB3F97OfyYS9j8jTyykizluJ5 NORm5lYQApFa7fvFbanWp75k6exjLjaquNPsxmpkdv8A3Ef+qv6s2UOQayvySHYq7FXYq7FXYq7F XYq7FXYq7FXYq7FXYq7FUj1rU/0XpesX31drsQFnNtGod5AlujFEUkBmalACeuY2rnwwqh6jW/Lf vbcEbl7t3kcfnnUJiL19Gma0Mi+pYx6RLBcogjYyDlJdqjHlxoyKw6gBvtDR5OydPL+GF+8V9gdh HV5B1l+Pimn5h3enWksFtN5ek1hJLdpeEVi94g9BVejN6saoTxHEHqcOl00BvGocv4q6LmySOx35 9L6ovTLqWHylLcT6egu4pxH6cNpLGh+I0YQGZ3pRt/j65Xk0GGcyCAbrmfI9WUc8xG/0e5KNM83X 0nmWCwm0Wf8AR1y4iW5/RzxorFT8TSvdPROaMtfS8OxBLLsnTRgSIxv33+hRq8hNEmvcz5UsoKyG 0hcLvxaMNX2zDx4cUT/dwP8AmhvJnLbiPzZNpd3b3EBEMXo+i3B4qLRWKhtuJKkUbtnWaWcTGojh rp/Y6jUY5RlubvqjMyGh82f85I+dNf0sWeg6fMbay1KCVr51UcpF5hfTD9VG3xceoNDtmuiHKxh5 VZ/k759u7Rb63s42s3jinguTPEqSRzKGRl5MD0IrWmROaIckYy+jPKf5eazb+WtKTV/Msv8AiGwB FvepGzmG3dFpaliwMgjbnxfl0NKUpkcuGOSpCXDIdW7S9o+AJQlATxy5g97J7fyVpdvptlaWupNH NazPcvdMtXkmfj8e5FKcBTMfN2bCcYiM+EwN357fqZS7XlKcpSiCJDhruG+32oi48ote3GmXV3rL XDaZdC5RnRfioUb0/tbf3f45l4NKYgcWTjo3v9zhZdVE3ww4bFK+s+T7XVvNWl6+92F/RqMhtOAd ZA/IGrctvteBzLljEpCV8nHhlMYmPepeWPKY8p6LeWCXxuraeZpbZHTgY+YAKA8m5DbIcHhwItcm TjINKuYqGR2/9xH/AKq/qzZQ5BrK/JIdirsVdirsVdirsVdirsVdirsVdirsVdirsVSPWvqR0zVY 7yJ54J5UgaCMBnczRxRhQCQNy1OuY+qrg3vpy53ezKM+E287s/IGiWl01xFoeqtOwiV2lkaUskFe CkSTNt8Rr41JO+a0nMdql/pR+tmM8f5p+aczaTod3rUF1qehyW15d8LJNQnt4yx2qsZdX5cSV6ZX GEwREmUQduXX5s/zcb3iybTfJemaZbG209IrWEkHhDEEXap6A/5WZU+zpSHqnfw/a2R1QHKKK/w/ /wAvH/Cf83ZV/JP9L7P2s/zvl9rf+HoGBWSQuhFGXiNweo3rkx2THrJj+dPQJja2draQiG2iWGMb 8UAUE9KmnfNlixRgKiKDi5Mkpm5Gyq5YweX/AJheQbHzZDaSuIxqWlTfWLBpgWhY1BaGdQQTFJwA am46jwOstyISoqXlS4Q6WlvNpz6Pe2IS0ntXDCMejWnoSkFZYviPEj6d8w8uKQlv1djjyxkLB5MY /NTVPMWo3sPlbQFklKQfWtRWA0LKzUVCdvhHWld6jwzKgOAepOmjGROT5MB0TX/OfkfUE5wTQJNs 9hdK4ilAP7IPcdmX+zLbjLk5OXDDIN31BocU13p8c88LQR3cSS+jIOMiFgGAZT0K1oa5dixGjfJ0 E9jSKTS7M7eoWaldiOnjkhp4seJAXluLecxhuQpUeO/jmNkhwmmQNqGQSyO3/uI/9Vf1Zsocg1lf kkOxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Ksd8xXr2mm6i6wxzl7hEEcoDJvDGasCCO2YXaGbw 8V+dd7CZoPJF87PJrq6W2n2iSzHihWe1PQMzsLcjlSi7EAk8TsAKnW5L8G7G2/0fZ3MDyR/mPzi+ hTxJFbW7gw+tNJHLaWdxFSP1FIdwjcX4OK8u3hUrHR5JmXFt0/gvmO8BYlMtO/MjzVfeV7jVYlU6 hFzUaekltIPWiEgMPrKrJ8ToByPTuB0xyavNGXDx7XHfh6G+imR70q0T83PNWp629pDbILVh6kl9 HeWtyQvpqYnNuoPCOTfiVJJO5FOl2q1OWGMHj3/qc/mmUiBzZ5oHm7VZrtobpfrUSxPNIyBEdEjp VuqKRVht1yvQdoZZyqXqFWiEyWaRusiK6GqOAynxB3Gb4G25vCrBPMes2WnxqtzdRWomJAaV1jBA 6gFiMj2fjhxGcyAByvvcTXznw8MASTzruQ2ivbzSmaOOO79SB2t4mKlJXC8o15Hb4mHXNxqaMOIb +bq9Ftk4ZbX0UNQh06DXI76901bDUdRUwS8VDx/6O8bW7ORyVHZmbiSd+I70znO0MciBLd63Q5Y0 cdjbcBJPMnnHQNH8yaNbXFp+lrz6zFI9uPjaLZkjePl8Ik5uCB3pv2zD0kSJcR5OfPGZQNGnonm/ zU+i6RBfWywyNPcLbotzKsCksrtReRXkx4UCrUnNnOUjG4Vfm6nCMfF+8MhH+jR+95HpHmDTPKWv T3mmeVopGtoEivb/APT1qN5yrughmkahZir/ALxk5Hk+7EFrYcVerm15OHiPDfD0vm9u+oQ3UYuO bcplDghldfiFdiOo+RymWAE3aBJK5Y2jkZG6qaHMOQo0zZDb/wBxH/qr+rNjDkGsr8kh2KuxV2Ku xV2KuxV2KuxV2KuxV2KuxV2KuxVJdVis5rHVIrsuInlWjRirhhDGQVFDuKZj6qMJQInyYy5PEbXT fJ8muQvD+lI7+4uRJFqE+jhCSTspkMKlAY/3dSoPHeo3OYOTATAi9q5Wf+KYkbJ75t0rTRq9sk9r dyypbow1CC0hmTgw4fVyzuXBYgPQLTYb9sow6aUeUttttx0G/NiIrdAGl23lC8vbHSNQtbS2uBHH YfU4ra5mK/AZUgaRAFbl+3xNB0yGTRGZ9U7uvhzUx80DoVz5VGrLHaeXtU064vUjee4bT47cVlJb jIxcMzKzfHxDAE7mtclk0JlH1ZLASY+b0zSdJ8rwTK7yfWrsA8babgSNuvp/LvmRoNBhErBuXcf1 MbjFPJNQmbZAI17U3Ob6OIBrlmJ5IdpZGNWYn5nLAA1mRL4382+YdW8y+Yrm+vXaWaWUpbwCpWNO VEijXwH4nfqc5icrNvTY4CIoJ/p3/KxPJNtZXssE8OnTTOGsZKshoFrzTf0y1fhOx2y7T62eI+k7 d3Rp1Ggx5vqG/f1ZlbeadahunuROXaQUaN68KeHEUp9GafJrs05GUpEkvaQ7E0scYhGAiB3c/n1+ KYeV/M3l/XPN9va65qNpZrb1kKrKkDNIlOCNIW5Dc9OWZWkjPJMcViHydZro4NPil4dSyct6NfBn nn7QfPd5qwvNKW0Ol2USmKNrvULZyqkGVXjtX9OQsOXGsZpSnxc/h6MPGsLs4fNd/q6aZPBCmpSh RdegNfhh4zoFkdbhkSJT8CmOQuWArHsfiJV6j5GXzpY6PcRechYi6jnY2klhNcTK0BAIDm5q/JWr TfpTYU3jKQAsrStNJ6srydORJpmtlKzbaGQW/wDcR/6q/qzYw5BrK/JIdirsVdirsVdirsVdirsV dirsVdirsVdirsVSu6t/Xi1BQQpWZWBY0G0MfU5VnxmcaHNjLk87sPy00+38yx6nAq8ofUNskVzK D6krc3LIs3pPyJYtVKk08Mxp483DRiWsZAdgQgPzG/KzW/MOoG8s9KtLqZrX6ozX11dLEUCckHow Oi/DJX3rRwQVoZY4yiK3+xsCc6B5E1RfLF1pGqWH1X6zRJPq15NMxUclDLLJxkVgvHeta5CcJ3YC CC3pv5RaPYXlvd2dlJDJbksgE7BSebSDmvL4grOxVTsK7DARmkKr7l3ZT+gJoIzO9wVkDtIkWxQS Mix1NAGOyDblmTpNNwmzza8gIDyfzX+XPmHUr17i711RftT/AEmFLuHgVZZY/Qg/SSV4yKCCsbCo XupObWOmMhd/f/YPi4c9dHGeHhP+x+40T8AfvekeV7LXLLSUtdZuYbu4hYxwywLMv7hKLH6jTyTy PIQKsxbv36mIB6tkiCdnx/8AWGt9U+sL9qGf1F+avX+GcsXqQ+ndbuTqujRjSYfrV1qUP7hBs5hZ RI1Kd6b0zDo5IEw39Rj8Rzczs/NjGa5GhDc/cHmnmrQ9c0a4sNMurd7W81ieKzs5DSnKVgrupBI/ dg1+7xwY9HIT9Y2G7utT2vjOEnHK5Hb3efy+1Ifzn/Lyy0ix07UNA05otPhgC3sihmZWLGkk7Gu7 FgK/2Zs8GW9i8rlhW4er/wDOMPnTUtf8p3WkX07Sy6A0UULtQk20wb0VLHf4PSZR/k0zYYiT1dfm jRZ5ffm1+W9hql3pN75gtbfULJjHcwSMVKuqqxUMQFY/GBQHrUdQQL2lOtB13RPMmkQ6rpkourC4 B9ORkZSaGn2XCsPEbbjfpgMQeapfLw9V/T+xU8flXbNbKr2bQyC3/uI/9Vf1ZsYcg1lfkkOxV2Ku xV2KuxV2KuxV2KuxV2KuxV2KuxV2KpHrFtbXNjqEVxJ6cZuImrx5glY4mClarUGniMuwTMZWHF1m OM8ZEjtt97DIdV8vN5gi0+K1kgmtZUk+sxWN1ErtH8ZjEzloKUXdg58OuZHjy3G+4/HR1/5TGBGQ AFEHYb/7oss1PztZ2SUFvLJMVV1Xi/Chp1dFkpt7ZinGXZR1ESV0PnfSprWa5SKf0oHEclYnVqle XwqwDMKHqB+o4+GUHUju+5TtPPmlT3LQtHNGrMFiYwy+AqXqoCjkadcHhlkdRFX8w2H6bsLiyiup EgnT02ms5OMqV68WWpUnLIAAUdmMzxGxuHgPnS60DR9UvNJXVNdvr6K5kke5F4IzbPKYy0ULFGai iPhQAfCWWu+YebVxgaFlzcOklONmgy78nfMGn6he6pEl3qLXTqjpY6hdG7RYo3cl4nKowYtNRwf8 n6LdLqRkJHItGr0xxgHox2b8lPLaahLdz30/1IO0jQEooC1qQ0lPsj9XfPN59u5fojEcV1+A7UZT TJdN8++RbWdbeK+VUhjeICJXUqpjMZ9ORwE5BT8PxZf2ZpdZp88cs4y4L9W46+VshpcktuXF+N0g /MTzfBLL5aXQ7S51S10fUEv7u4nZBOVSIQ+nECRUMtW+dM6rJ2hiyDh5e9zI9h6jF6qEvcUH+af5 pLb+XfqNnpMzG/SGSO6ukieCKhSXhJGfUUyKw4lGHH3PTDDRzjUpci42TJzHVU/IzQvN3lfyVrXn GOyrcamV+rRSxpUW8Cu7XDCW4sUEZd67yCoXbqK7DDHq67NLek1PmLzZHFb3snmC2tJnkhM13Jb6 WyCOSQyOU56g6FGeWOI0eo+JlryU4ceExN8Uj72WbUCYoQjH3X+klmf5feYddu5Et4r9dd06WRp5 dRRLQxqJnPOKP6tcNxSNkanIHrSrdFuLjsv1RIkueMahRxHIDYV3zAzgCWzZFOLf+4j/ANVf1ZmQ 5BgV+SQ7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqk2p2lxc2mopb0M6zK0YIqKiGMbio8fHJwN Fo1EOKLyXR/y61XTbuOJLFIrW2kWW3me4vZmqgYBfTkf7Gy0XlTrttvaA485kjr8lT8yPJ2salf2 2pabpEV9ewQJFHJczXKonEGRawRtGhAkVTWta0PVFqyCMRrY38kf5Q8sX1n5Tu7OTQ4bCW4dozpi s8luY6yLuKEAOGLEAd8Y7IyWT1PwSzyN+W3mDS9QF/caTZi9uGZ7mWJ7n4PVoX4CeScA1AqR9oAD agwCgzyXMULey6Xpgso1rK0knppGeXAKoQdFCKn475DJk4m/Bg4Bzvby/Q8YtvK2jXP5ieaE1O3j mvre+N1HHLyPKC4HqIQvIKQOQ5VB7DNBqbEy7/AbgFG6Gn6H+cPl6S2jVX1H93fKPhDm6d4VYgUF akH3IyWkmYzBY6mAlAgu/Ne/ng0FbSCpkv7hYSq/aZBViBTfchRnJdg4BPVSkf4L+d/2rpI3K+5j enflDJqGi2F9Hfm2ubq39eSGaIsgFQQQ6nb4WXYjOvlqaJFOectFT0jTZdNv73Sb4+pPp5iC1p0m QOOhYbV8czeztFiy5DkkL8vPvTqu0cscIhE1fXrXcnZRBue2/U0+7OkqnQl6D+WmvXst1LpFxK0k BiZ7fkalCpAKrWuxBrTMPVYxXEGuYVrj8n7Ke7guJdWldbedbiKBrHSyispNAK2nIDieNa8veuYV tabeU/LmneTtNksLS6+tq7BkUW9pbBaDpxs4bdNzvuK/jlM8wCQFeSR5JGdzVmNTmDI2bLYyG3/u I/8AVX9WbGHINZX5JDsVdirsVdirsVdirsVdirsVdirsVdirsVdiqSatFPLYaokMkkTmUfFBx9Sn ox7Lz+Gp6b/hko82vJyeMRaf5/8A8RW1vLq+pTPE0UlzHDazJGYlcK45vf8AoD4Zyf2iacqEqoEt 2u40m35jWPm2y1mPVoda1U6J/owl03T7YytzACVBgkil48h6kg4mo26HjiViQmHlWDzDF5T1O81S 71R3uUj+qxXSRrdQlUKl1WCR1PJ/j2YfIDYEIlSVeTYfM0XmEzXmp6tdyO03GG4SRIFBVWi4j1fT Cxj4auvJm8AcMee6Mp9Pp5vZ9ON4YWN0GDcv3Yfhz4cR9r0yVryrkJ1ezbhMq9X6P0PP/wAwfLvl 681ozzwvHqV0sUC3kRKyL6avIGVgfhqq8SflmLLRSyZYn+CX6G86+OLFMD647/NDvaW0kkUssSyz QikUzgM69OjHftnQ49LjgBURs8vk1eWZPFI7+bC/zZW9MekmxWRrtLlnh9IEuGUAgrTeoOeW9kSj HU6gyNDiP+6L3nZwsfAJt5K81eYWs5bfzNblJIkLwXJAV5FUEuGUfDVR8s2U8+GUvRK3ZS00iLHf XzRPkzTLjUjq+s3vlxbnU5roKsbSsCtt6P7omsio1GAGyhqV9s3XZuphKP7uVur7TjKEhHol/may t7LVr21tiPRjPwqDy41UEpU9eBPH6M6LHImIJcIHZM/y/q3mCIhipMTnkpoemUa7+7RLkmd/+Z1r bes11p9ysERkHrSXmnqCyuEQfHcAD1a/DU+xoc05w31a+JCw/mnZPC7vo11HJyeOGIXmmOZZI2Ia NCtyRzUKxYHpQ9aHB+XCeJmeiXVnq+kWmqW/IQXkayxDkj/C24+KMuh+g5A4gE2yaEUiQeCj9WZk eQayuwq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FUPeXU9uFMVnNd8q1EJhHGnj6skXX2xVQimlSe 7H1V5VeRT8LRGn7mMUILgg4quJB/6V0n/JD/AKqYbLHgHc0SD106T74f+qmNleAdzqj/AKt0n3w/ 9VMbK8A7lwkINRp0gI6Eeh/1UxteEdy/63P/AMsU33w/9VMDJJ9e0251DhLBaypOo4tyaIKy1rQ0 c9DmVptRwbHk4Os0hybx+pjF1A0FxJCwIZGIINK/gSM2mOXFEF0eXHwSMe5AXEF3cXLCOJn41ChV J279M8TyYjLPkEBxS45cveX0zQTxY8UdxZAWnStRpvayn/YE/wAMs/JZx/BL5FzPzWP+cPmtbTdU KMqQToWFOSo4P4DMrQ/mdPlE4xnsd9juO5rzTw5IkGUfmEpfyp5hKmtk5qD3X+ueo/nMXe85ac+S 9C1ix1Bbi6tmhUQEBmp9o8dticw9bqYSx1E72gsyaIOVZ41ZkNUJUEg+I2zU8UkUGjbxnrCh7fYH b6MeKS0FUSTKKAkD7uuDiK0m9hdTyqUktJbcIAFlkMRV/dfTd2/4IDNhHkGsovJIdirsVdirsVdi rsVdirsVdirsVdirsVdirsVQ9rZrBPdyhixu5RMwP7JEUcVB9EVcVRGKuxV2KuxV2KuxVAXGhaXc XDTzQ8pGpyPJgDTboCMujqJxFAuNPSY5S4iN0Ta2ltaxiOCNUAABIABNBSrEdTmLDDCBJiAOI2aF WXJVssV2KuxV2KuxV2Koe+s1u4FiZioWWGao33glWUD6SlMVRGKuxV2KuxV2KuxV2KuxV2KuxV2K uxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Ku xV2KuxV2KuxV2KuxVBx6nb870TMsEdlMIWlkYBTWGOWtTSn97T6MhPJGIuRAHmyjAyNAWUpvfPvl y2JVZmuWHUQqT+LcV/HNVm7d00Opl7h/Y7HF2Rnl04feg4PzL0V5VSSCeJCaGQhSB7kBq/dmND2k wE0RID4N8uw8oFgxLLgQwBBqDuDnQg26Uh2KuxV2KuxVZBMs0EcyghZVDqD1owqK4qvxV2KuxV2K uxV2Koe/vBaQLKV58poYaVp/fzJFX6OdcVRGKuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KvOvN XneK6Y22m+oojJAu0mlhqT3VYmSvTYtX5Zyev9oaJjhH+cf0D9fyei0nYu3Fl+X62JXl/e3khkup 3mc93Yn2zms2oyZTc5GRd7iwwxiogBAX1/bWMBmuGovQAbknwAxwaeWWXDFcuWMBZRGh3emahJBL JKUsi4E7AEsAN2Wgrvlv5cY8ojl2j193kwOYyxmWPc/pekRec/KhcR87yNBsHLzcQP8AYyE/hnYR 9oNNdeoD3PMy7Gz89j8WR2sOn3cCXFtPJLC4qrrcTEH/AIfNxiyxyREom4l1mTHKEuGQoqv6Pg/n m/5Hzf8ANeWMFj2tkhCvNIrHoDcSg/i+RlkiOZDIQJ5Bf+j4P55v+R83/NeSYoe/Gm2Fo91dTTRw R0DMJp2NWIUABWJNScrzZo448UuTZhwyyS4Y80o/xP5bH7d9913/AFzC/lXD/S/0pc3+Ss39H/TB MNKu9H1QS/VJbgtCQJUeS4Rhy3U0Zh1pmTp9VDLfD0+DjajSzw1xdfij/wBHwfzzf8j5v+a8yHHd +j7f+eb/AJHzf814q0LC2IBDzEHcETzb/wDD4q76hbfzzeH9/N/zXiqjc20McaSRvISJoRvLI43l VSCGYjFVe00+C1Z2ieZi/wBr1Z5pht4CV3C/RiqJxV2KuxV2KuxV2KuxV2KuxVLtT8w6VptVuJgZ e0KfE/3Dp9OTjjJa55Yx5scufzDblS2sxx/mkfcj5KNvvy4YO8uOdV3BO/LfmNdYjlDRejPDTmoN VIatCPuyrJj4W7Fl405ytudirCvNvlryvY6fPe8Gt7hgRBHG2zSnoAhrt407ZzHa3ZulxYzOuGXS j19zvuztdqMkxD6h1vued5x70yTajqMNvrFrI8K3UVsG9a3fo3qAdGG6sB0Odl2B2ROeI5CeES5f B4X2j9qMWmzeCImc48+g36X7vJNdEmtNVvb2YcLNJGMiwhl+BEVF+yeHKp3NPHMXtjszJHIDPaAj 9XxP4p2HYnbmHUY/3Z/eX9B59PxbXmTUdH8varp+maheKtxqPBopBx9NI2YjnJVhLxoh3EZHiR1y jF7PTnG+MfJzp9txia4S9K/LPXdBu/LMk+m3gu7WKSRpLlacCQATxAJPSmx39s6Ls/ANLh4ZHl6i 6XWZzqMtgeSQefPzNudH1CC0ZIUiuIzMiTzTwIIkIWR5JILe6pwLry5UWh67ZUck9QCQTGPcP07j 9TICOI1QJ7/1bftY7a/mnZzGN449Me0O088F1PKI3ETSNWlmE41WgYuK+x+HMf8Ak33/ACH62z82 fwT+pPvIP5hDWpJTp4j/ANHXlPHH9YRGDGqVSeGGhdCG2+zUbsOplGel9USa7tqP2/aokM20vn+P ueg69eWH6Aku7iMz2xVJUQFlYmoZCCnxAg0O2+Z3aGphHTnIRxA1QutyRW/T3uPpYTGagaIvz9/v eZ2vnprrU1gNlqcYb4IJ5nl9FeK82+NZmk+IgfbUCqjx30Wr1s8eETBiZx5/vJHa9q5fgfLZYRcy K9J/oRRGp/mbb+X9WmtIrC8kuGYPcTw29zd+okXJQryMW+Xw1IqNqZk6LW5PXKsY3reZskbC7v8A Q0anGJcIJlt3RFb91Umt1+bEdro1vqtykMFtcGo9dhAQpCUr6zoFNXpvlePtnVSlw8ESYyINcR5V yq+e/REtFiAviO48v00gbT8wtO8x24hMdrqa2rfE7PG5MgFGPGCRgtOXQ9Kjr1yHaPb2o08voHCe V8X22B9idP2fjyD6jfw/avsptCso1is9AsLWJYzCEt4/RAjZxIyjgRTk6hj4kZrh7X5v5kftck9j w7yyPQ7fyhqEMkP6Kihe6/czxNEWjmCK5ClyODgLI/wnpvnU9mdqjVQEjEwP2H3F1uq0MsR52Px0 TeHRNI0fTltdKs4rK2NxbsYYFCLUPHGDQeCIq/IDNq4LtX1Ke2nMUV7ZWv7n1P8ASyeQPqBeWzIO G9PniqH8rz+YrpXvL/UtM1PS7hEk02fTIZY+Skklmd7i4RwV40K074qn2KuxV2KuxV2KuxV2KsZ8 7avqNlDFDa8okmr6lwvUU/ZB7HLsMAebjajIYjZgBJJJJqTuSetcy3AaxVNdL/MLyn5Vi+r6jMy3 94wYqFqAi1VantvXc7Zi55C6Jp2WjwzlEmMSWfaL5j0vWELWbksAGKNSvE9GFCQR8jlcoEM4ZBLb qmeQZsD88eWtevtS+uWym6tuCqkSsOUdBv8ACadTvtnJ9t9m6jLl44+qNcu56LsrXYcePhl6Zfex 3S/LGoy3qreWs0VtGf37FSoG1QpPatRmq0vZWU5B4kZCHVz9V2jCOMmEgZIS3tLV2uL9dKsnsy1w sfqVklVoGAUuJHPLl4KNs3x7QzYsJ4DUIigO6nT5uwdFPJc48WaRjKRIsHi59Nq/YEwOoT2d/ZWl t9VtEukLh1s3G4YIq8ENR/rdMsw5p5ADM2fcR97RLS4sVjHHhA6Aj9Cn+Xfm7VNf1BotQSGaCOFJ pJI42jMchlKiM8ieVVXkCMyccrO7VnxCI2ei6xbWlnpkhiRIkZ4/UJNNg4p1PjTLO0YiOE15fex0 e+Qe4/c8l/Me41J72z+rEPYJBMzrD+k/Vckrx4S6cGKESqgIIJ48iNgwzB0XDwnvv+j+lydQJCVf rYlLp3m9bh43W2HrcI4DHda6GSGMsT6tHHMmNWAcslX6mppmaDCv+kHGo/i2Y/l7c6ul9dw3alrW KACW6cakAXhdkjCfX+Sf3e7GN25H4jTblg60QEb/AOJ/Q5On4ia/X+l6xdaes3lxLK4cQkQxKzkV 4sgX+IzL1ekGTR+FM8Ppjv3EU0Y8xjnM4i9ywKPyJbW1+99BcRmZw6n45+JDsGY8CvCtV28O3XOT 1Oj1E8YxnJCURXSQO3+a7bHlxiXFwyBPu/Ws1zyHZ6pdzPeCKUOxBUtJQgMWFV40y2ENXhlIY5wA 4ievX/NYk4pgcQPIfjms17yJ+ltGjsZZU4ozgAyXAVlZVRg/plC3w1pU7HfqMdFgzYCJXDeUia9w 5XHbdc04TFUeQ/HNDeXPy3XRmupY7i3WW6cFljNwsYRFVEHpt6i8gqCpGS7SwZdUIjigBHvu794h yRppxxXsd/x/OT+Ly27mj3kKb+Eh/WozW4+wZHnkgP8ATfqDkS1wHKMvs/WyzQ/L0OnRLzlaeQMZ ENWCKWBUlEqRUgnfO37K7M/LYxEy4zz8h7g6XV605TsKH2/NHah/cJ/xmg/5PJm2cFR1G0v5iWtn g+xxEdxEZFLFgasQVbYDYDviqJskuktUS6aN5xXm8SlEO5pRSWpt13xVWxV2KuxV2KuxV2KuxVB6 tqVlp9m093vH9kR0qXY9FAOSjEk7MJzERZeX6tqKXl29yIY7aPoscYCgAdK0pU++X5c0MEOLJKo9 5cOGKeefDCNnuCB9eH+YZgfy7o/9UH2/qcv+RdX/ADD8x+tJj5c0DU49avNZt3knjctbzRc3YQrE gURhD/eBg/wnxqQRmuz62OWfFjlcfx3u/wBLgnhxxhIcJZF+T9xp2kaRbS6ldCB1hZY4mDM9JZC4 5UBpxWgzIPbGmjAQMxY97iZ+y88s8piOx93cHo/+NPLH/Lev/Av/AM05X/LOl/nj7f1I/kzUfzfu TrNm4CDjhWZr+NujTLuP+MMZyM48QpQUiH5eaGLme5Xksk4YMAW4r6hq5RSaKWPWma6fZeOV31dl /K2bhEb2j+jlffSy98t2ekKdWUXuoXECiGOCEetKwmdVoquyigO53AAqcsxaAQFCRPv3cbLqjPoB 7hTBdM1jyhoU0dzbaJ5lVorb6vGP0ZcMJYi5l+IAHiwk5L8YVtunGhNo0gHVhLOZc2ZWHmW38xax Pp5tdVsZLeV44ZJrSeCFXtnasnqSKYJRJxFOvyHXBk08pkkmuVV0/Qfx72zHnEBsL53fX9ISvzP5 I0q8a4+vR2tzq08Yi/SBhimuQqsHSolhljUBgGVXqtd81GU5MMt5iXlZ/QNvm50eDKLEeEe4fr3S H/lXGnmEQoEs0/eK7La2Trwmp6icPq8g4vQFvh3oK+ORjr5E7j7Zfo3U6WPQ/YP0s18o+Q/L+nQ2 k0TRXctmgiinWKOJhSmzCNUC9F+FVUbfZzZYMIyHjMuIdw5X59fm4mXIYekR4T39a8mS6tC8tmwQ EspDcR1NNst1+MzxGujVppiM93lnl78rtL0HVLfUbW4uZLqBSkss/F5J19No6TOVqT8QNRT7Kj7I pmqzauc4mJDmQwxibBQ/nryFdeYtRu/WtPVtHkh4hb14OYQjkWVYSVKEVUczyNPs9rsWp4NvM9P2 sJ4uLf8ASmeoeRbfWPL+jWd96lnJpsYVIrZw6JIsaKu7RqsnpsgK1QbgGgIFKo6iULIF8UizOISo HoF3l3yBb6Lqsupw3d5cyyxvCY5mDRhXdG2UKApURhRxpXq3Jt8rzZ55I1wsseOMDdslayu5Y2SO NwzCitxJAPv0/XlEcGQ8on5NoyxBslP9Hsrm0tmW4lWSSRufFF4Kg4qvFRyb+WudHpMUoQ9XM/Zt ydZqcsZy9IoD7VXUP7hP+M0H/J5MyXHROKuxV2KuxV2KuxV2KuxV2KpP5m0J9Xs0jikEc0Tck5fZ NRQg06ZZjnwlpzY+MMHuvJXmIxsBa8uO4KyRmtPAcq5hds6canTmI+obj3hyOyMktPnEiPSdj7ix bPMX0JJ76y1KS5lMNRFJQbMADQU3Fc2WDUQjAAly8eSAiL5hMLGCSC1SKQgstdx03Ncws0xKRIcf LISlYRGVMHvOervnaGtP7+9/4zD/AJMx4qkWseeNNsAzGaGCFQzfWrmQJHxQVZ1BIqo/mJH3Zhy1 RJqAtjxdzHdV84aPez2s0mr6cJYDMkCerFxYsywNUO0oLJIQvT7Rp7ZhZxkyEEj6b6d/vtytNqzi BFWJV3jl5hONL8vRXsBmiu4g5AWVGsrSo7jonEg+I6/Rgw6ITFiQ/wBJD9TmfyoD/Cf9PP8AWuGj RwJdXZvAJbEl3C20EBLRkuoMiIpIegrQ9DkTgERKfFvD+jEctxvXVu/MmRjHh2n/AEpHntyvo8x8 yanqOneYb+4itdZk+tvDFDLEJriFmZKGZY471I1j5IOTGNDyY1O9QNPCMoCzEn4f8TzcfNIiR5/j 4pZYa3e21vbQGHW4WuVQTXE8GpyhZAVEkfF7yR42Ic/Hy4LT7TUplxxRP83/AGP/ABLWJnz+39bM Py11K9iSe6FtfQRQpDGiXiyoPTiWjw0luLhndWLfvOK12+0Nzj58pwzE4keddR8h8G7FDxImJv8A UfxzeneYBcHSpfq8wt3DRkyGT0vgEil1ElDwLLUA0zcakkQNGvs+11UuTCWvWBas17QU3/Sk3Ek/ yt6fFqd+PTNXPLGMRIyNH/bD+prv8Wq22o3EGo2zpc3MccM6i79W7lu19LcPWMoFA6VcnbJYcwMt pVw87le3upQWXDzPoRCn62tGJUGjDcU8R75mjX4T/FzZ8YWr5q0Mqpe49JiATG6sGFfEAGmGeuwx NGQtTMI2z1PT73kLW4SUruyqdwPGnXLcWox5PpIKQQUTlyUNqH9wn/GaD/k8mKonFXYq7FXYq7FX Yq7FXYq7FXYqlvmC/urHTzPbqC/NVZiKhQa7/ftmm7d12XS6fxMYs2B7h3/o+Lk6TFHJOpPObq0t rm5kuJIwJJWLuFqByO52zzTL2hOcjIiNl6XHllGIiDsFL9GWX++/+Gb+uV/nJdwZ/mZ97f6Msv8A ff8Awzf1x/OS7gv5mfe79GWX++/+Gb+uP5yXcF/Mz73rme0PHJbcRySWurxxAmV+SoB1LG3QCn05 XlBMCB3FBeOebtG1a41yC/ivLuGxIaOBbWditHiDOWh+qXCIFaEUqwrWta/CcDBMcNbfj4sAWNQa dq0UzwNqGtyxtcRyTSyyXJb4zz9JeFk0JQEojhGFQWrRUpl9jy/HxS9V8hteaHarZXk7XMyu0Rjn uzcXLrNPWHizxxtJwR/2vs7jkaVNGLMBMkV0FcvsQDuyrVrSzvbm2hu7bhMSTFM0SzRn4GXhIf8A Z1APcZZqMUMkgJR376scjsfn83L0+rliNC6Pn7j+j5MT138rbW9ukme3imVKglLe1cvHyZxG/rxu 4VXKsFVuqjMT8vmw2Ijij5Gq+F/rcyefHlNk0fP9bDLT8lb9NWlu7y5hENa20NnotqjRlUKI/qyR TOzoeLK1evahphnqJ1QhP/ZMI4Y/zo/Y9B8u+TFsIpbe0txBDcymW5nMaQklgAx4oqFmPWpHXqco /LZc8hxDhj5/t3/Q2jLDENjZTvztZ3V15fmS1JEyEOCByPcV496Vrmx7SxmWLldEGu8OnmNnguje TtYsdSguPS02zZWVrq6s7dElkTkWeJQU+ENRQWLEnegU0I1Wo1uKUCPUfef2tZkGReYdBub3W5Lp LlFRCyrBJDFIA/I/GGK8weJI+1TrlENXHHcSD9R6lHFSj5nsL0+XbaO0aGS4i9SFFuYfUjcska1Z UVqCikkAUPTbJ6TKCTd7knY1XJYlLvIljfQxSyXVx63ELHEPq31YBGRH+FTDAVFajgeVO7V2D2ll BoAefO/0lZl6N5ZsL6W+YwwuH4ERXXN41hbf4iFFJK/ynHszHIz+k338q/X7kwD0V5Y0+2wHzzpp TA5uQIk8kFf3lu0KKG/3dB2PaZMgM0e9n4UkflrW7FXYq7FXYq7FXYq7FXYq7FUFrV5pVnpk82qz pb2NOMsshCj4thSvfwyM9L+YicZHEJCkHMMXrJqnlE3mby2krompwSIpIVw2xHY755vm9je0ozIj ilIA7Hbf7XbR7c0hFnJFZ/iny7/1cIf+Cyr/AEIdp/6jL7P1p/lrR/6pF3+KfLv/AFcIf+Cx/wBC Haf+oy+z9a/y1o/9Ui7/ABT5d/6uEP8AwWP+hDtP/UZfZ+tf5a0f+qRez56e6lDWn9/e/wDGYf8A JmPFWMeadS0ezF1cMkUEVsrPeXruYkqBU/ZeNSw7sx26fLW6gxMuGI3/AB3MCwS3/MDQWu5LdXmZ opBC0hu7N4vXI2iIW49UEnkN1H2T7VqGlkPwUcLM/Kvn3R7i5msGt4rOSM1LxtCOaqqFpTGkkr8E Mqqzk9euxrmVjyiG0gAD1H6Ug0xeex81X+v61JB5k1qOwMkjWkGmtbXKx85KpxqjcV47gMelRUZX HWTMiKsDu3/SvEV76N5tkEg/T3mVi0MsRb6vGn7ySIRB6RsOLIPiFCBz345L81P+af8AS/8AHl4i yz8tbPzXaafdQ+Ybm7vJOYaC4vmiMnE1qgWJI9h1q2+/hlumy5Jg8ceFMSerMcymSW+YXul0qYWs zW80gKJOgUshYEBl5BlqD4g5RqJmMbCJF4z5Z1/z9eeZjpmoHVhbQSPI99di1CSJCVjMZMVnGvF3 ZuPF+RC1qFOY2Xh4bvf4/rYlEedPM/nex8x3VpZwXQ09EWZbq3dX+B3IPCM2VwXkX0W+Dl+0N9xR hGJ6/j5qE28y6/r+n+XrK4hivJbtxKZorX02koFQ1q8LrzoaqvECux8cjCIN7/j5oCH8hebfMGq3 N1DfW2qWP1VQga/SGMSuCOTKYVUVH3b7dNhmHCNj8ipZvB5juPqrGT1GEUbvLVDGQyceMfqScUYt yNDUdPpxx55SAFuRgo8wxq0/MLVpdattPvPLF1ZRXbSCOaa808yBI2jUymAXHMonNjIU5caLTly2 sOPa7ckT8mX3XExJU/CZYqkeHqLlY5szyTdb+32WjADapH9uZg1EXFOGSKBBAI3B6HLwWl2KuxV2 KuxV2KuxV2KuxViX5o+WJ/MPlG4tbapu7Zhd28Y/beNWBT/ZKxp70zN7P1AxZQTyOzg9o6Y5sRA5 jcPmPOueJdih2KuxV9k5wj6KhrT+/vf+Mw/5Mx4q8d/NfVV0q8ihujNAkk07rPDcXcB5mVJokItr a6RhKSq/HQ7sF5GozXQgeOXv+/4sAN3n/mC9skRQNamtY52D6g0GoXBmjpyLCFI7OUgUikYlQnIj f9oZeAe77P2pDJfLWoQTX9tcW+qT6oJmeJjdXc0BSsqc0MMdnEDw4SbSbg1BNGJFOWPpNivh+1Be 06BpDLbJeyTzfWZ41QE8BSFCRGoXhtVKE13rlmnwnh4iTZH2dFASex/NX8so45LaHX4C9t9ZM0ch k9atorSXBZWXmSqozHbcdMyYYxEUGQFMi0PzLoeuxySaTdrdLDxE1FZShYEgMrhSDt0OTSmeKpfr 17HZ6ZJNJCJ05IhjZuC1dwoJeh4gE9cnDCMh4TycfVZ/ChxVfLy5mmOfXYBNbrLZxBLmZIVaC9SZ wXNKhAgrSu+RPZeMg0TsO5wvzxBjcY1IgbTvn5UmmreRPK+rsp1SyjvCjck9ZUfidxVeQNPtHMca cDkS7Sle68paHdqguoPX9MkoX3pypX/iIxjp4gULXhUNL8i+VNKRV07T4rSNAQqQqI1AY8jQLTqT XCcETzsrSW+cjo6aWIp9GbWLN5okNkkSz/EXBErK+1I6cq5j0OL07OXGPDHcPHmm8rXF1atP+Wlw 2m3UDLLImmKl2jBmgVJByKqAi8qxspGwC+EhCX878fP9DbLNAxrg+79QPzJew6ZPbT+XdNntbR7C 2kitGgsZE9J4EJQrE0Y2QoPhoOmUnmo5J7BZyy0JHFPE/wAMnDCZe5hPKAmaKFUKOgFBmcBQpxCb LeFDsVdirsVdirsVdirsVYn+ZvmvU/K/ld9T063We49aOEtICY41ev7xgCpO4CjfqRk4Rs07jsPs /Hq9R4czQonbmfL9PwfMmo61LfX9xeyW8Eclw7SukQdUDManivI0Fe2bmGtyRiBfJ6LJ/wADvs2c jI+JZ/pD9SH+uH/fSf8ADf8ANWS/P5WH/Jt+zf8AbP8ATf8AHXfXD/vpP+G/5qx/P5V/5Nv2b/tn +m/46764f99J/wAN/wA1Y/n8q/8AJt+zf9s/03/HX2fmheIQ1p/f3v8AxmH/ACZjxVCa5punXMay 3Mi28qfDHO1KHuFZT9oV7dfCmVZNN4vLmwySiBZNMIvfJFleCWNrmULIR6jxXF7bswUkj4kTku56 B/wyr8pmH81pGaP4B/Umml6Bpen2hjluWfgXdFl9VhzduR5zTj41BOy7L2pTLMWgJkDOj5BjPNGj v9n600n0ew1ayjtec8JZxepJIUZpAa0LLVtvj6MAc2QzShK9u5xp6WGaAj6hvxb1v+LUrvSLRLh/ VvY2mOzRLZwSsARQKfgZgOOw5HpjGZI+n7SuTCBLee/dwxP6PvSrVdIWeWKUsRIrvK0zLBbVbdyS 8SyOzEjbbL8WXhBA/SfvcLU6bjIJ5je/TH7RZZL5dvGmhdXYgt+9SFy3JAx+JBz+JkXajfq6Zi6i PUfj9rs9FksUffXd5b8wO9X8wXMlvpryJtuA5pyPHeu1DlWMbt+pkRHZ495X84eY77zEfUurCK1l Z4xDbxXq3LJCrqhEshSMDkGNAlKHqdmNg3Lj5LjDa9vcv89fmJqmlatdWplYLZtHJA0lvJcL6ssi LCVKXUFSOTjhSvToOPKMqZ4+I9ft/Yj9U89+YbPy7pOox3EcjahcMrvMt3GqxOQY/hhF0Qyofi9R lHUnj0BNMI3dWdvNf5P81+Y7kzQSz2ksMEamAWfrxgEmnGRJvUWh68uVTvUdyYQB2LHPklH1RJt6 Rp9vJcwl5lWJwQP3b+qjAqG5KxVKj4qZhZdLEHYuywaqco+oC/I2P0PnmTSvOPmnWbu95lVE0qiS WXiqcGA4IoJai1p8IzUTlRd1EbM0/La/12G8uPLOrymSWNYLq0LvzKoZkUqGNTQ81IHbfLsFyNBo 1FRFvYLa2EIO9WPXwzY4sXC6/Jk4lfLWt2KuxV2KuxV2KuxV2KuxVK/M8eiS6Dewa5NFb6ZPGYri WZ1jUBtgeTEUav2ffJRBJ25uRpMs8eWM8f1xNh8h6nBb2eo3NrFcx3UUMjJHcxMGSRQfhdSPEb5s Y45Ecn13B2nhnASJESRyPMIb1I/5h9+Hw5dzd+ew/wA+Pzd6kf8AMPvx8OXcv57D/Pj83epH/MPv x8OXcv57D/Pj832zmrfFENaf397/AMZh/wAmY8VYV52/SlzpM09lMkFyZoys8jzqI4klUhVFsySH nxCsoahJ3qNsyJbCg4MPVLiP4Dym41bzrcwzw3JeOWeGMRG2HmJ6slZGNEW2MQf1FXqN6qxahC17 uRQ/FJjby+dptWiTlC0v1lgoa41uBJQg52xDALDXjNxkDBg3Hr8Pwu6NvxT161t/q1rfm0CwIWiD PGoVlqQJAGHT4KH2rXMgysxvfn+xwoQ4Iy4dhty+37Pk8o8+Pc2fmlpD5geytIkiENqmqSWQ9cM0 sUTRQ2cw/eF+DcpKshBKkqpyiRJO7l44gRoBis3me3Onwg+Y9Uhh0zlLqUc15fQPJbzOyBvWnsjI zsvILGGHxH4X+BTkbbOHyegflPri6pBeXEGttqbWciR28Es7z3ADMTE8wlgtnRpFbgaKQ2/xE9Lc Zvbo4+cVRrfp7/28nrWsSwxadM80TTIFJMSfabiOVB0322ymPNyctVReIeV/NfkifX7HTdKs/MFz NLL6UV3LdR3UBUozepM5uJKqUk50I5U4/DsuTEmieKxv+PsTzznctaavOw02a5skZPXmjub5ZasQ G9O2t7G5V+Nez/OnXCZFAxj8UiPMWv8Al7SvKdtJqDLB9a9e3hS+uZbQ+pGvBv35g9RWqPtcK/tL XEyKI4Rat5M8zeU7u9Ono0Tx/V1u4WS6luZnRmILGP0Yz6Y2owY1322wxMjsFnDHHeX4+T0pbu1F otwrUt6bEAig6UpSop0pmPllwbyc3EOOuF5ze6VdeXr/AFTUw9q3ly/uTdRSNKUmimkp6qKnBudW Wqqp7ZqNTjFHJY4XcaTimRjAJmw+LzVpdv5ln8xJDcT3renHbQMyRQrGnAkuQHZixTptTMLDrxj3 Asu7n2BOe0pAD3X+p71BIZII5CKF1DEfMVzo4mwC8dMUSF+SYuxV2KuxV2KuxV2KuxV2KsJ/OHyt d+Y/JFzb2ZY3dm63sMK/7tMSsGjp3qrnj/lUzJ0mUQnZczQ5hjyAnkdnyhm+endirsVdir7lzmHj ENaf397/AMZh/wAmY8VSrWvLkN7BcW01vHe6fdV9e0kp+1uw+L4WViehIy8TBG/NxJYpRNx3DzW9 /JlJNQ1CVYLeS3vGWSG3vILq59OVIRErPxuPSYbGvFVJG1dsHAO8J8Q9Qfx7k08j/k/b6IsDz2lu Ly3jEcd1H68cZQSPKK2zTzqWVpTuad/liOEczanjlyFe/wDH6np0FnBDbm3C8o2r6nLcsW+0W+eV mZJtujjAjwsY1vyFa399FeNLcv6I4pDHd3FupXurpE6xy9afGK02qcs44nnsWnwpR+ncfalUP5Z2 0dv9WRtTEZFOTalOGHxGQH1VlMo4lqVB3GxqMNR7/vR+8/m/cyjRPLUWn1eSRpW5c0RnaRUalK8n 3P4fxyMsgqgzhhN3L8frTW6g9aIpWhrUH3ysGm2cbFMJ0L8sn0fUGvF1e/vSWBWG6uXljVQhQKAw 9yff5ADJiQa5Qke5k76bcFiRxoST1x4wxOIoDXfKh1nTHsJppbdXNfXtZpIJl6fZkjKsK9D448QS Mcgs8veTTplusVxeTX0g+1czPSU/Dx29MIq1HXjTETrkpw8R3ZEtvAsPohB6XTgdxvvvXK5ernu5 EBw8tnnP5p6devp8FjapyhN3HJHGOtZFMYp/smpnP9oQlH0Dldh6nsHNATM5c+E/Zu8iIINDsR1G ad7J9Q2f+8kH/GNP+IjO1x/SPc+T5fqPvVsmwdirsVdirsVdirsVdirsVdiryzWP+ce/Kuo6pdX6 3t1aC6kaU28Ii9NC5qQgKmgr2zOhr5gAU7LH2nkjECgaQn/Qtflj/q63v/JL/mjJfyjLuDP+Vsnc Hf8AQtflj/q63v8AyS/5ox/lGXcF/lbJ3B3/AELX5Y/6ut7/AMkv+aMf5Rl3Bf5WydwerXlhBdhR K0y8K09GaaDr4+k6V+nNe6pC2sME93qAKyxmGdYyyzSgP/o8TcqBgB9rj9GKon9Hwfzzf8j5v+a8 Vd+j4P55v+R83/NeKu/R8H883/I+b/mvFXfo+D+eb/kfN/zXirv0fB/PN/yPm/5rxV36Pg/nm/5H zf8ANeKu/R8H883/ACPm/wCa8VWQWMbwRvJ6ySMql09ebZiNx9vtiq/9Hwfzzf8AI+b/AJrxV36P g/nm/wCR83/NeKu/R8H883/I+b/mvFXfo+D+eb/kfN/zXirv0fB/PN/yPm/5rxVa+k2TsrOJGZDV GM0pKn2+LbAYg80iRGwLyLWPym12O9uJ45rcWclyiQFmcuVuJQiEqFP2eY5b5z8uychkaIp7TF7S YY44giXFW/4t65p2mQ2SUR5XYqqv6s00q7fyrI7hfozfxFCnjJyskozJMXYq7FXYq7FXYq7FXYq7 FXYq7FXYq7FXYq//2Q== uuid:251f3f93-f84b-433e-ab8f-e0ed85e00f2c xmp.did:4c941668-c161-3548-9541-67dc34b42863 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:e1fe89c8-0974-fc44-bfea-8c050fdb0c45 xmp.did:8087bd0b-217b-49f5-95b1-7a20849c8ddd uuid:5D20892493BFDB11914A8590D31508C8 default saved xmp.iid:2444af53-fbac-4297-b0b6-08a320c000c9 2020-04-19T14:05:44+07:00 Adobe Illustrator CC (Macintosh) / saved xmp.iid:4c941668-c161-3548-9541-67dc34b42863 2020-06-24T14:21:22+07:00 Adobe Illustrator 24.0 (Windows) / Print Adobe Illustrator False True 1 16.535417 11.692917 Inches FranklinGothic-Heavy Franklin Gothic Heavy Regular Open Type Version 2.00 False FRAHV.TTF PSLDisplayProBold PSL Display Pro Bold TrueType Version 4.002; release August 2009 False PSL030pro.ttf PSLDisplayPro PSL Display Pro Regular TrueType Version 4.002; release August 2009 False PSL029pro.ttf PSLFreestylePro PSL Freestyle Pro Regular TrueType Version 4.002; release August 2009 False PSL233pro.ttf PSLOmyimPro PSL Omyim Pro Regular TrueType Version 4.002; release August 2009 False PSL114pro.ttf PSLTextPro PSL Text Pro Regular TrueType Version 4.002; release August 2009 False PSL001pro.ttf Cyan Magenta Yellow Black Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 False PDF/X-3:2003 PDF/X-3:2003 PDF/X-3:2003 endstream endobj 3 0 obj <> endobj 5 0 obj <>/Font<>/ProcSet[/PDF/Text]>>/TrimBox[0.0 0.0 1190.55 841.89]/Type/Page>> endobj 7 0 obj <>/Font<>/ProcSet[/PDF/Text]>>/TrimBox[0.0 0.0 1190.55 841.89]/Type/Page>> endobj 17 0 obj <>stream HdK,IEo YcĀH9<2dͮ]_saޯ2ۏte31}1o?5k\slůNJS^]/?}ݫky1Ω]my? WIWe]6ݯRڽw^Uu^0r &*㪕8PlwIce.Ժ̗WpPWbz9$mm(CX=V 9wk]Hv6\]rյH#*Y޺V+.ϔ<ך7G{{x+;hְK#=,%8wDb$*krb Ǥ{< gS._f\*Υ{Y)@D~GE#j}z5b\AA ύtJd|q"0Ǔ5qvWBz1MH c)󉭈y&̴|\yODhV.4zbAVl~#T2`: ēnniqj0Dd<+ WlBDktt\bdj`D{c~擴o8]-QÈ=q7lK- ~0'mr- TD#t+׌-rxJs@,x(!Kho;nn}PęT}LnIͤlWE$fA])vW6ae%wيl7ʲfN @&j BS?wNdY@ $ƫ 6K58}#-{S5J>VIrWLA& )H8,Y$i"8oEst_px DZр,{7&W˜>ap] nl4 ^\=}S _)OjH\ 5mcׂ(jw v"|o3=@;Qd/v^ApR3!Kh90E,"&a ~w7͑.gT; xl!&! lG^/,n"Ԍkc~γj@4u9%֡^'MgNZqM#XbdKd( lHȆ u E#l}NإsR}/:7>mց׾xbmʡ= \C' ҴwwP!J(,JљrE舭8vbB5Ob N;”!ʛ%{ş䉁πP+Ħ_!f w&rB$xyMcZ5b'A`iw!L%n+jW;"K ڹN8*A{FU AMN tO;O( ފ"ɧ.7 =-~}g<6IZkc&')ۣWk壣) 1+-$?ʳc=a=O 5#Gq޺l=`lIͤ- 3@F:U/#腺~. l+gEh QB\c0hfqg$h}Rs E} 8=qHZcv_gŬ36s=hǯsD6 IDD#Q JgRb!/ӹ1ۥzӻc\{~߾xϥlI0',g4N6<,>D䩳|\zd(pC u˂ABdḳ bQJJwCz6WB˞1;CU4O[VikwdӴ\F_\>TZ4.EE%騁(#,fyiGԆg)Q*<6qÖqZH0l|l}"I_B#Cy)9Fi=?}Z@!wͧ@# q6NDe7 ʧl*j[X՗KTU/A3Eq.HOeyczi`KS>Vr vgEDY嬨h㭔> ݄zZj9FIdןFgd>#=F&uoN ;tAVَ%o#\rȑ ))D0=6 f+o?#Y`*%GYWN@) >[,w6>]~!T1F4䙂J<7vm<sfD4/+PEm ݎ/E 6,qnۨT@ۀ<5%WDݦJ d^G)hmFuDjQU8JvF~f4#MTFË!3m`sEԼ>ěe}[i KvXb9m"=6t*C8j5%D /WđK&K}<ˀ%~2BВ#}ԓ}ȓxYh%mLJX.IeS&"Cl'!"[GtC:;7$`xVP_D%[?)hyM)(6Xg~vRz`aa k~:"oη?u@;Cn#m 趠%E>S nʜq#]K)Y3ͱ!Jn2{ح{źKFΙއ}"cFsᝪ/hEřis :y[ ^Vl!P>u9g |L'l\R3̿!"b"Vpg@&Ѳ<\"6-2(m.OZ5Uoc˜i5m< faU!1^Gce>rJ/Wy?~eO6S9^]S&XNc˱agb0N0.#S3SrAq/)!E >gT,BxE+[p fzi$b쵩_N F;^%4vn)Yu&n-R@@C y:@؂pP<ގc|> s=|Wұ䵕)-;v7xN9 NsZ>'T "'+nc/+ƢVT =jNZ~VGDfQ7..aZCCdihbMgѴ='QPqK&*RaW5gIoƖNhzE #0k6(8Yv帢GW X x2\#wn A:SRƧ?zDz}]463nmD?ҏ{R4AtV?2\x<24F\?kD~gdX]B;oي?Rl :r\պbDtIhsb%p mR]t+! 1ܖֿ{^}O",]&˻Lɤ,&Yk"$;]/rB)NCQ Wפ ׄ]oPc^r`}Ҏtn׶qa%5)L?,i>f+Ho~Ĕٿ   -U?uIdB$Q" $ xʮ'[q5VcOl9ZF8.N|. E'ܿ,ϹlqU+2Z~|8'b}$*R+ ~ԫ;ԧvQu^-,$+ugbgX%8?LۗSV2rM͗1yݷx7tжq)*I[Kuִ4mSE+/DQy2vy4G8dJC(bb&sW =k4=rsuvVH`-. ҂#:p}mu9 9l<PrD8- =2t8_QbΦ_\ R Lv.8X"),$vBg1\=潜tx8?0gC5VکsCF5Kj!^,c# P>2мNB۪le>tLܙm$JwESeƄ ĜW|L6+K5y@@~JxVpJpM\A6j/*,)oFC2%>pI";TP6uֈ&Q9 aԋFzvEnq $1Ob DQ.[tCY_F꬚qy$bS32NH<`T:I~4vxKfe5]jmH~[~}k.EmB QyS[6_Y|T{Ƅ]:|d8.'G(O%4B ҍ /syq9Hw$I 2nUAu|v&$9]CES(Qխχ1L:FaB;Y*αWp!:I*QT]|_YLꈊ\@Qk}GTGtRՕl#< @9Y\%-V6]ˉ RaBܢn?p,>i !;j+VfeaO4F3X5^DW-7HJ R|pj9;& D聓x tubm29ڵD:7:]/ej<±|T+W* }Wjx=yw~2_~U;/OĄx|FָZjǧe}s\Ŀ#\|H3l+??&ygOae;߯j}=X᯾We53^QZ/^Xz|8,g\ǎhf`1g|w L z^ii_9amv'o {c>ks3Hxؙ$G期q4ݛB {5k#kߎݦxDiZΜ; f笹7Y[R{됲uޏ`$6 |}r};pV:U?q%Dz,WWd1պ,hܷY)ﵪ`S S$Lv .ՊrPvFX3hq@Y0/Htz!b:V[!rX9Q PFe:]SsHTMV%1DŢnkGT2[JUL V%mN0 Q]C\KUM! cz"%#޸CPx]GMXzQs8S% .bd(K#9Jor7H0ŨpWl2 УMQF1Y."HOTeyC47jBKT|pDB r9Sa:FHB\Хi*ȵ"^ٖu[8"O')kK\C-|$yu2og~)+D2,:9f̗H#9whOR>NIME$>j#6.bC_>7r{ER!\؈1ZtZDSwìeLG C֯I7O{M 7*6^?@ÿ\~zB) gS'O>Vx=7/ƠBcIw?ݷ_7 Cߊo+w67omm}7f lov'Un|ρ%NVK?_ZqXTMfQӧCzڨaQ{8TWyZZLx FH]ڥFgrRa֤UuŨ#ǔTw*mmWeqCXjbRGhؚWHYy(DT 2V5nۄf4ASַۜtPdH#?VXawgʓ@ŞM5 iErf\TqDFXʨ`FJFF9Nni|yP'`<|8D E~zf7jcl:鹥z~ Y!-eI,˜yJu{ Wk8v9_;= sH1nL(ӜDO9yL>N8U\TC|Svs[>nR䦉ɣT3Y8# 17 g6lq !(b.yFd*e"\cρ %UP񭘷EH7o5M\K'_>M|'6HP[l!Bm[y})ZՈd\6 B%˗rS6ADX!$PQ1*ًMr  @ü\Ca/k7&sl־=iX}sӼx&Tý7 _ՇxQFrrE s"$TM[T]YC4NO5VybAiG/*{RP^.=Dׯ?pۖF#Uu5 vH%@BH N8>{,ڙiocؼxkƇABSaZD HKX{mCCZ` /ԣIGDѮf6tGYԅ b؛$'|Ttl#n o7jdMpKezeB3;py5H;&ܒkrĮ:vA%"СDgÐl:6U`[M|Qsd]G:yQ ,Vaj&TXs+AD˄W V=SpcɥDqtK xB%_&SW)^v݈찆P ǘ}tНٶC3S*`b!u$彺eNuUZz.P8reFI)yF$[ ߐ jz+*hko|Li%'" T7cVA3tOQAL+LHH#tUBk ЬMq%ɝ^}K9{T|X i( m|#B Ҷ Ћ@-jv,M( sj1KvKP0%D1DwXUªDӏZVH+!9TܮǤI5\İZFU@|y]w|L+~i3%?=0cw@{kJQJ 4 ,, ̂5^Rvr؝!c;mx#P#QFX2"(@Lª=f*rCSȃS*:"~xְ ]}+P ú\h4,LCWViI'ɞXW`fPKG9u~[-l@_ã}A4Ȅf\)`!,00T`U`?Rc>Aj;cIZm%0↞5 Γ,~W2Zsl=&T$30,P ,bX:!F-<"% G _)얏ĭE>:S[aufm#D-jisQ,i@d3.YC7* Y N8d#,ϧRkI ,D#'4< AqhNW^ov1 J |}n:,-P})"Kߴ.xo^W]i~0m_o1'Dk-x|]6zB6YY{Ql2B_drF/^G4[<=(A9udw)&N;]5Rr&ڲH^ٯ3\B@l2XlT,FrϲXE1Q9'A~xDu5Gr!yy*Xv þS"OUVwRd`ŀ!ԥb .;CYL%_@+ Gf]]\ 4#2:[}~N}D]C`@ Cڀ[,TcQ"9BuDΧ8y`* s:zf*\V4lV)(xQN!t  .,}AiB`,-; 9nNȂ`a5` A\kgU]HbY'4+v>dםj*G2LXV.4D>^ڍ;>z`n`"?AdC깗Gh/BϽ࿏{Gz.RxO# e=kS;ޛ=gIc9_>dC'ZX\\SҮ6sW:z_/k6c\";ݥUɫ_3W~GkfmvrSg{|N; KY|h|!WP6[2+`>v B,K2Pܗٻ1dFa>5aߘG-Y+.eQakfvyܗr$E}~]g#"2@UpGrdL B%yifi#Z /fhL1;d;MfקyXD괡Y)" փ#ƭ7e&eW@y>a;#إuaJ1 VG)b(^kI`7gtg0i@NJoS,Da# ;4XcM$ EhhNOmКHso֨RE)d JʝdBdѠ}!Y%$E}'٘y.$f$+KJݙB)w2X+~aY6`g&m,Kue[0maY*Q?,zƲHe)##+˶QʓeigY.tvָ,.,]UggٮXe[V,[(0ugY@0MqIƲ&˺s$kӏUuE¤B4lmL3cϡZ-uR%h2IY޸ F]m 1_cL-k^{G_Kehy>pkQ YBDďŋ:^=x6=K+mqp;Vg ߵ[xw~i1g k󶫋M.3M^lC`StfD˴Lg)g4ayIS*o"8<,i[;[AlLlb;# lC`!kyZ9ZxL^x^sIlmp67P!B[m&uB[%hNF]^~> zErppųt &=Ȍ#6:MY;edxgYҙ`Igi9$O:JeљrBgDT).tzv:+cBgXo %ׅ03˺\,t7etV2Z:Ud3!_LY:kf< c7"Bgbv:Jg~TNgNgzKW:S& Cu2k8bʋ `Y2X2LQާ|$PŠ'Jyc#DQ睷I3XkScM`gwt9cOL"@ G+t~{8t4Є#*Q8[Da6c26ug&cHfRS.:VȚq:':;[(K>>_#z(4NO}%[1^%:s> ëJRU>lҥb:q|}drF[(KF!OLH*|ݒŔOŴhA)mhǛ /71I2ވCVIzrŮU52HUK=-iIJU9zC1̏R=KdœWK:C+iF{QI+h=ٓF(͗?6À;S WeN#olTtB=l[(iNm UFӨpqyo&m̳CN?>3Vz~ywd/УA;7}As?+VZjF|Hj@j1yr7a3R{ _"5  ؚ9A aK1{r[;V(W8&DgY;$85V^(5I+@40moM?}Cz ᔮ%֤as [gݞ|Na&7f-%QKkKKk⼶xhננ>z} z}^z~^.H ҋ7HBhWWQ 4 nĈ+բ"h煮kFRDOԾRsUֹ,&m"ʂQ`}B6@ {E6/9diERf_@!iIJ@//ENyB"h!uoOm{޾q9fH^D^"-Q4E +Jȡ(Kaow<`14sZJhy O"Z0(J.T+4-ؕf ׋HI,|"pLb1tU4Jn_f/MqLNL^rVRXg]Ҋ8 85]DPuX]ojpQ e1wAJx@p!:rZYT++eʃռrm'_ߛTNG=DVcE*Qu׃,jh@b+aTAډalnZTbɰ{)5%h"N%7|$`&beXBlA mS*/ Y0+酭m!zOzRzZzq%rGzm-^\I׷ҋ+ŕ7WGZ7t L!ӄxbj >;Νw;>G6֯u{׃ݣ]O4ƩqwOcν]=qWu߸`iI2q\ ;uv֩:Nx߂~0og1HlyGY}ji2jA:e[/&;g^дe<^Nq nMf?Y޿xX˽q #f^u08HG+u/^n|)w2Cf %_ƥ &5syTT=9jfrX{fM_1|Fr{~V"5`\V*h?<9u}^uUYNՏé hK[\Ţ6 YY<܁|ԕr:V ~IsM]Ȏ\?lohowbWBzQ'Gd9Ej[V-ˋts0uiӷR,ݾۛMi=7ڼؑ9;}Oj:?<,y6e@˘\Ǫ@ tTo'[Ŏ}Ȕg6Tr{ţ)&;uK'W**ok)eqo|[IFԊ{e9iym8g4nΤT-+r\^0e".X| /ѓT jYOCBZᕇ#-\tzڥt%h_hO]괈 v#*,}-Mr6țÅ֎cÃ,. /3B#Tb}VEEgZdTWmje5LN[7EKHkU c)q&4m sÏ$"kDOdyY8pn~wgv S 7~B p KSw ?IPۥvt8_Q۫8r?T.g{Uf9SgrdNk?+©[ϯ9Ls O~_8{POyξtoL_wSo8_38&ӟsa7)[nQU?fm[Ye`eJ{)̹ջ͑jT[ w~A9̪ns:!tSNA b-ۡNE;|dI>|} Onв;hc܌N~)&yʲtrJ|9dGPhE0mJJ-+)OUv!ՉK<;1wiť/DֲF˵xg+Ѿ;%,F txb,fȻi]llV.@Ok=;l]hr*~mX)&IJHlt^p-{MXƼ+}L:mРqNb=]A%Ej;UӅY ğt_i"mCl,%:K QuC6nT\rYA%`խnv('o )hBj#.s#z&~ f}V_L6>S%/zr!dӰ'(v5cǓǾH 4hW8P >Ah- U6JeZQ v35XC$sS ijӫ 0]-jtg6o Ӈע$jVUqkWE<.eqՕ銘߷$oQVe$aG$WB'=լT%hW^^`tޟH[*`}\b䘬Rdz,oi Fۤmbݡe5C'P O%W1M{T@n_C'urԑI Po]҇02eP)Pf vOS9(9_ZQfW3aXԤG!F3g_<-@{K*ņn'҄,EyeJ6(ebPEH0ӫH9h[d)JL ah 0EWT=Wi,SW1 9Laj!ԗ}vAQ2?{#ػl# ֚Jզ5pr]ޑvÚԫ>yD2Q-$:Zx,=X_ٔ8_e_3u 7mZYMSeןjjHE}|.J"JW2>'"H&tM=PToJUAӄcL. 8}ѽCHyqwCpӤaXD`@t@5@㱔p@=mR3lԑFcVȇLXKU[ ղyl#vIpq} yQ|4ao$nZ³m\aӒK|9iX&V$awNnPi{mQ]ju//3/h(y'@WB(^K0L०(h& C ['altIMZ-›iNFj ԅ'kNڐ : 8I\Օj f7 {:=eFAr-1T] fg)Dq_@]|sx*=)ۂg8PP TT#w%f !oF5;KђŃFL{vCc.^vN|G Z+TΜCaZ8Dz,()uN^#`82\޴%KQ٩wPWL<βOg;ч9zLa4*qe&g,Vm$yO<,6zZZٕ~)+MZQG,Tx{6 ?SIk|eʒEO;}H8Jߧۿ~a٥a^;{|/Ձ#G7O޳$o_Tǿ-CzN]?.qVJwJ3ë{x_t/O ~h3ZGOyFlO#/0M?{9}g]~.=_McƝ̤֎v^ᮿNs)5I+ (3NHfRm Uc`FW+URtHl!CB$q5<MR%*ѧs2R%. Yƛ Zv{2Dm1}{L؅RUBddaDh<Ýc|*웷F+\V6X1-? bGd zScN Mu[gIx6 x:/[1/%yHhv*,=Sǧ&Ir[a.$f,z1%,䡏ʿC3Zqާ :$Qcѫb^RzDG)G<8?u:IJ$% ֽ:HT9嬑4^N ::rf&VM>Zr jdPV.TKs_vՖ / ͦj&Uk]$=ye>7J3&@+>;xyv'@'H^7Ir0). %luf!8SXj~w W ΖU?)Αȃ_z V,stn\s3lKPgf63!Cf^ZGL䣃a)L q'?!s!ؼ.t4;HkAڰ6ѡ]z+q G+U_e 7A)AYA10aiM>VF(2(e.:3 40#h:O4,@Mݘ)1Vs"/n/Wϕ .ӗgC_ 2wFXpkȏs[Do~_Nk4}x(w9Bt6Zc5bL_{#HSi4ݮs[6E~2PY\W!p@e2C잓+wo4@=ٞ[8],NGgn"gŰu:uI`uՑ qiŹ},Wսߞ#;DjBZE*55W|Cj%Ke$nV=R&{EMe ,Z_X?~,:j89]# y#+;'蒘q5Y* [18/ ,EOd<nRz,zNu$a(9/r!r!\hy\q44d3S\# 2{oV3VnݩY"˒3e7Ǟx+" ) ф-w~G.O?hS-&/?ζ(0dBxmSiiN r 1o*F)-͎8 NK*fbN&v426Oc]*?zhC"$Sy˭QVNOH \̸J9CKʚb{zq xKfwq[{j+sкKmxIfalhUZ纚΢:1 _WۏAg"5BɛDwn,K6TI,Rfp|84-.Pu/t\ٷe>)+.u8l!A54Ȯ2f^ ?`k_7a⢤hQ'f\ qiRB!K}^v~ %*;Q5Xׂ̹`RhDTwytTbR EgSHukZ겭J$"/86 K_XW߉#AŽ**-Sų b$?~y@R <'nC7cFB++o +QhZ*vECew--]8UblXL fnZA 9$ 7UOJR#XUkh;NydxIRWnk`j@bz'&[~Lr+9ڝL}26Ӈ([׿VIQZ[gq'iC:Mmq[G8/0y+ G@/jdGPfbJu|_dF'zf q<id_RѦ Z6(̥2r`GAq+ )cIQ:Nr~ ?{H5ˑA9E>y|b]-6 .4׬TVs^ȕHyҰp4kk%4ן"Kb(/aKO{J7?oK4մ)(Q89>ͤ ZKZ_r 68 hM==Y)&(m=;m*ڹb0R'y|ds%Owҟj&UfS$:Nkb>_B tEXrt2gR/N/ְ ɮe6SgϢ>"ʌ7꞉ZݽLPwjR묕gakڋkqWwԍGh!(uc+ǸjNH m2f: ^E!4CdjP\>s&Jg) ^ԙ@)c#U3h:uM8uo6V/+St޼h~Mz)L"l+|ҙʛ6?]졦A)Hxke̥_4rdskϗfVS{N.;I]ո?&a ڰjh𫂔$ BgyZiȢ.f8j `n>hYA~d e.ֹEW+4|W Du'xt QE8VI7(n 7 G£s(,)ef6tJ~S0m˲!"o m<8n~n| #›,41:鶸@m&ufgr,d϶wҢ#P5EvTn7l?87Ö,=+~^# 9Ax~dwX> /ީuPn؃+9r2f_5Wq`ՠ]^֯|~mo %{L]б}^IvuBx wfb<>$243`DFZ!ݽ?z#Ijj"֎Q 0dۼ=hSTܪW&\,Wnwnj =;HXJAݘI>u;@ܮ-C_g% bKCkU(R\H#OZj5UFW @ +A7PMkrv`FpU7@2 ukJq&Ns@fڹB]'{U^,|b~(ltty#")sfv@N | [+\k\LhSb/7.;pOCo& d%txnmh2Wjۼ{B$&uQ?Cڵ9&j$ߵ]uy P|/ȡxWYTf :َ_˿;|~$b ~e@@V:5FQ̨›<#&YaztJBpJ{DIc4B)̵p^^|w3(cw)'XK2~ᬩ*X<[5k^t|A0t)̇`*3έN(%w1Ym5lQLr5HgohV {um J޽밴X((Dk"ۧ}ښ^[WD7&88B^{7]*e%JBf[`e3xib=kGXb3n0>혈]QA!Rͮ@jZ5ZQ)p2XmYd\?߄T&P- W4r^/cZ5K/OMV[}u.~%kcQMM kw5L=ò4KCV۞pBZneG 6%ߍMתPߊEi|V+tEb0E `0ʴ $sžuRL黛)px(MDiVN) o3RH@٧5k!+"px`P6f9JB%;:P!>vލ=ciz銳)7|LScuaһ캄wne*'wY6͇R* qYس A RG7+5! m"Ycd#>\` Rsa @쇼êbglcl<[bUC4'YSi#O?Fl>\t$\I%^=iG( m՟sJix!.ݾVܝXCH6Pp)1;c$ѦOyh8'I/m}"\mEӶNU8I[@PtVgZ\l{SzBI-G;4ѥPM;4ŹpڠJAҷC6=̡imS,~_MHP~^\ Ze&)JUsTvU2Vr 3UDEI4:Ѓ>Z ^|4c2)o(#GDŽxd2R]a3;H#o,ַB\mspyV/ޖvo V&IkpVJ߀.N WF!| gG'!gcwzv$Ex쎥vėqʖW `<{rZq,F2Xu%nhEdу"GN&;vӋ[,Էc=#-L|wbRph;l&gKgebĎ#xZ)( }31?Տ>JUbe! a>Qu?p$IUY},o;.㏩*'=xyĂ<\L*c-bR+VZ0BuFjtOgiJ0tެ51cP/Hx,#{.['&zu)nE'BP67_uQ1֥q;~L ϡ1Oz4y'a ]HT d/ xxJyIZx]0A׻))q)`M93vVaDDǹPŦuѮ + 4J I?_X)MYCgh 'ozuńWZsxTQx("_KljM!8#0[J'ǫ梎r3tljۗg#r"aRJЛA+qCzR°/qrrppU< ujSy rޏPp_Kp"^:I)"Ah 3;[Ͷ5Xo|>Mņ:Q:̾RuL;)A<Ϻ@vdɌiElmmMW{5 jF(|4T_!5Y0V~U|q^20[?rxko`>|4?1Q(?GyC[3J?SC7 [6#4j"ԍno=yw^<.ЫIS( CNGt;^/0C)rKk2Ry. I 9A3htYZs׊#`\.@_y%eg>%I#$5Iu֭A4.]M4%S!KySHF>,V-+?|ɻ <\FT0?4, 0qx\]V6`^H8mBg)tIמm?4B5+|;]DbG m GL惷rmv͔?|y`5N\z:=yhu:mtwӋ`rb)PCط*bŒըubZ5,jy9q:x:v9kn|ez唎^[Y}lmCO}.ftos$)/C}vjO}x4X\;nY-^[D\݇ͥC vٹm}=TdSB0 @ӦMZw=0z`z`tE-pW-0~wZ`W N~؅&'+NcULby &Ёq*E]~dtu([[J,Ug Pf-Wa:uJm9nrٸq*ru}5X}nk$O% ~#K֥oRk2W8hԥ%!bPɇnHR3A0ݮ0&%ܾY{=2L[CU}lGFjxV[Hj̜4ncbDn8Ťn~tl@F՛{VړmjzZsrBLsv(js {pa 2|oY4M;8X^=3k)fN0LkM m*J^ÛL2!kuKH0>*P# 8L"@dD |&GF^c1{侳kdԒ1 @!. !(Cs8 aqET6ŻH+H,7؉lt'$UFpYHNmt4I8M 2cGmn0.O`QngrB?C8 mOv-#ZvS[@ V !C,צM7cb`h[#k&HA/5DѲ{x-^B8DzS񛏀Zc 5J%CGPսp\%#]:f@^!Gs>67̓Ԅ9O%^ f՝m ?LPuŪf/LSX0ruT^.xNH*O? V [_SVr7I3JyH{z0t8!PO5XbGT҂h ^6b!Zclؠ`|ݢՙ(*[IDAʤ8+f(~fu:y1`G(]]ioUaO "UoӅd|`e{{hHz^.M?8?Jkq'5*ĦN$v,-&^݃L,lbzA/P`E[sH#;Si`N(@+Jtãȋm7;rrci7zYl\WVg5Jul]yI#Aӫ)-4g +j-fK>R°oX#OsIVwn)st}dFGnj&!~O6>) ii5ėF%Wy(FE"wO3QEBU"ߗѯSǾy0L}dx{ n:-̏X e!Z)"oӰHKE 9%@:ԩ\`l#F0< {+ qVϬz}]O4JwLƼ|[$SQ&-Pw*VX fP$OC֤բx8B ܋ym~Y0*1Ce3˳)fѢj p67!c*eXCyK]n˛yə䁶"Ŷ*VࣨZzc5 zVfxRl+omG-&њet''YYI<^Z 1ր/VYae/Xoӑ =TՐn^T fHT>CCR#]U6jZ5ȶ|fK ⅉ&[ZB<;Rf)u[#-hjDVJ=h 'yE%8\"nȢAtL&uy xQ+ApU5k}Imƨ*,—x)fHB4SGiv81a7!HPmU% o}.%`$  U'k@RI7S JM/vy3jX`Z'1&wҴ- zcӬk$E3da@}̊s|1Wgy2%G)WN` T=ࡸ{wRL/<{ۧ?24Q=|MfG3\@XImmqI^k/TxhV`\{Lq9njqC+U8Cb&^Ƈ  d.78P+ X, .{O7aV51a?sr.hh*3Y9S v"*wG1Zbn8Y˟\YBrtDh b3YNS,.{G*9MiC`eV6S>EN`HUݷigQCK=dYQMv /4Jx |nV{t T +סr(|?}~;5{z_ -k[EFR^wrf},o/޸^N3|yAAQL_ F#5xP]D{&"^vlI:&>ا(Ƅā!`1Ĺsu1{ AtP:Ǣ۩>Sgp ԬSPpPU-5Je}P6AM/]2ztf%BG/M˔ Xԛ.Cq܏ۦY_xCn4 %c0Xn.2 4p=Ub/$/Sg>͆&B )d{ڤNwTL=Y%Y+?3Ctjl#JqR?Gÿ& *q;>sʌ sj0U OfrwP6VQ5%*2S-Ll1BbbtwԑS0(ml-fҊTe ߋ׻|wd{Wr%\;A!4x3 1&nEz)aX3&A/,N:YT:ckC#h>/`u ΢wYjœxL xB«$%<:2[Zo9dvwηv sMqb bFnѵ/"ټʯz}k']}(N4Mqpo%.kdz4i:)! LMn\kupCj|5ټ5f0ZxT2$5 2dh5hq%]~6&0d^5nSol!@3~lɤhkM4{{WsLpdu-7+'!0gycZDZpKC:R!ȬN[<;qS=z&i_-u%!U;`W3&OJ'~[2~w]s\eP6CA`.% jkJJΙ-Wc?`f5bρҰC-L NJ! Kc# +vs'J +};m$ η0Jz}TDć>3gj<iB.&|]&)cŤ?^KSئ$tH5yv^)q|mPh,-.0AtA\V_;ZNTu٣!< 5Ko|RVSWt9K5vMԝG2љfe9A5H7;HT`I2!w"6ĒTՔ((uh3ٯ^@{_  p9̤&g%DIP 늃7߿?9sC}։BJ,ڒqx+V=w8T~O; %~kp'W 2uҍ߷T4LžAk5U6רrI#O(y9#&s _ZvxᆊE@ ?@5;пFvS߷R= '~ uy= fY5o\ nolw]5?< ܗ:Ru c wzv=jecΫ%V늑YK"N!T)}X؜Kڦμ#0ӂ}_6Q,9;`@Y{\6TM˜2m$s}@uKȒn7H=>ƣ#ѹpR?n ֕W(:ԡ!JHg}tL3qnPl aOrLS}ZkKAQ{onzYF5G. -&VڸsZx̿_w&Sz_umW/$5#}޹Yb>ݾ[u$gI䨽9.Uwi|YsT$ L k4(ێmwc=Q"nb$VΖ˨BV%乼t & \W0dv)MшyahNUWtxqqG ۝G8bk;N6Sqɣ<?Yɺ[r앮# ZrujH-3dN;MqE#Xyc *2 !eu[yT0hONҁvf)AۄnျоU! Nv͝e;X;叠?N;Ip"arJrm !4=XVoe9tdᯬ3MtoV^O+nՌ嫷ȆʁY˛e9NY+jźf"_Nzgq/In~IƩisd'V/xyϮ:4Bw-*#kVZ5={8^z+TcF(67v 3cTsg! ׼o4m^]1/4O^C ҜoLATP{ zB>_VCa芤nȕ7@|0n_*H-axx?'I=_[Ԧa,>/+%^ga)49ͷyv]G+)y?uTQwKOJp(Ҵ򽝿u4+ur{Veu_D5K,]ڎ{~S\u$Tۤn_J4^7>tպka؉ 6ҠW l~ae yyVd\^cS2e1 Une  %ֈ%>C?Ha3kH˛59[v:ҽ!5&{&;z\6&K ;@g,֒FfS rM9-zk rx3@Oׇ֥q` 8L%Q^̨F-H-bH'8r+ċaay=RL3vL(zi-lOlˈa|SZ_rxGxy=7~D Q[m{7RAeA£2CA/#a4,3Z@JI]Hpȷ;先,FhAZh To6|;4#Sg9fq fWR{hl`^:<{t 7g>Bl 'kK)FD]{8nQۚ=&oޓ }}MKq}WG,'Z<,X̶i6D}=aΓUN:CNLjmo~F7@>MZ_?>_|"h:9Xh} #_׷`~s̷`>a>70_Ya> 0!̽a~|]nsw(v*ݔ1j>~GoՄxg۞ًv2l FySMJERvf~G(Z[lțb&v͝HzN: 35yW6W\ˌdZN.+Ԑ<2B2h+,)/@K^a$npK3{,K'[ZyVr!6S}^?dt0<(!,uH [3ml KFWx{0 xH>bJc=j@Zv߻)3?XKN4` 3_YK f8k(Sh0x`zWAy$(+`?TmO ɨrAͦ{Yx!)"'8 ߤ,]S}}3Ϋ)L7Lq+z+~8jUAm|u%95BGqh5>jni; 1g3A0l-%W_MpiMh/l,ʡJ$G Pm4; 12 2 >$i`}*!?K' .>P&O;T;0xў~}3O(Sy\_f=[?_[n>QdRw:G T-Irlh ZQh8ѮdBKc?h8qȁjpu&(?LRKQ.3l1jT,hOKSzUЙNAHMI׃$Nf'-^?ˑc;aptČAgT ~ )-ip|`>A DAχ)2{ɞσ$ +9[ZQLVνg8Srt\)Nl(ÿxIޠNluȢQ5Zfa(g 4^WM=x4fAAz 41 ѥ]g l`Ͳldj7nͣZ6[TAΒW+R+{&٦(C wc8z@&S}s3%3*zӐM}=C*FE@Կ~Jlt-pDI0 /mgrRrxGܴ_^.SXTX2U&d.ڮע…ހA^` d)B,Z U+Ε UG Iiذ(*4hK&Tl{Cq Ңi19Ԡ@|s^]uD+2 EB3NzWlji ח-*F _/z%]wۀIDR iA,P97 C}%t=6K Ey2gus dGLRR|nV_x*K# ꠎ6\,⤣ 5a2)L|0A9H-2)BO/rh^O̯&AYOMţ^5uD({7u&4d q\{cyIԍY 2'IU7h /i/5b=#UoQ;mhx 'n9vgLb?kP&`G:Tݯ[ug ]Kh\JʤxoIX׍ &L`ʌa`÷ͅf7Uڵ'rcdM|Z R\mN@hQ1PX籮.ivT !@2n25M[dV [J \9oC51LdyδU])gP̷i*0N0^4/nU=9ް@-$LEir2I54 B NZr,mOQ(Ju Gh cF\}L>E52b-k&Fо˓B,7ޤ0ަ@쇺Pt(j;4s;$j#;wp]q;O JV 0uX`z aCLt5q EWo^ܽ79t5{% j^Z"V&t<?ŨZ^(XK6עE' +#m7ۥ~nj`cPr pSQ'clܔr2ߘǏ//:V{ M&b GBF?7?c`!}"fqٟ{HԿ +Z+xW]89͟U8v*a[& ^Y,ӽѭb$mm6,Xa.!CaF%+=N5=s%d)9߭4 .l?4jRÑ4jaR&ɣJ%t)hqZ LF2k{BU] V4(tᒜ3oIMS#dɿǘ =p(z"~k:d}~6:cAFdJ"0gə&Q,<.J?[r~n82 .4@CΚ% *OgP+Z">@Ɉ3w6Q 5[Cٌ5>YG 9jo ޓLq4\VnQѢ~rIN=ȧHשrӄ )nO}zIb+Fn.J䘯XT͑Ge$ud;xRDBQdoWyLPH[ -:ȫ+R`$RdOq{*v^{Pŋ/4? gO{EqRތ.+oP(nBݥ\7:ɺSR9&|vu `3tP;y!蔒1Ì6N8GtQ9w]vTz~!Tn8*1I`Ԟ/Dnd~}A1jB/ۉ_υkhS%jd* ژs bm文YOM -.WDBƊ{Ε/U[nC^@ T K0{Or^۵/]u$OӆULӛ*;n_?z/ƻt) 2ĒM_mJ>9ŧmޤA?|T `ߡm/ya5@GIq{kLý4Q6ߕ1}^G㴇QbTZBwk֪@=4EBtbcv+ܚ:=NЇ({?B[͕@AS꼰s Z*uYȼr#!qlţKxէYɍMm vޯ~BY;"U^u+wڒNieDh6RM6NҪ(H0!]jl10P^oGECU5E-rMĬl6; Vjٳ_c?*A2l}C++FT4@h\&z;e6#s9=G^.ɣUC ?ّ, -׀NJ +g&QPHutJF_<`>:AU3-|4 YM "uI>#s9}- d&լҪi, wo)LlHm(_(;#JtwuV.Eš͍wvNE(ϻRoMC-֛sŚ N#6";:8.깣z񵚰HsE>1oնV{K#6%gێ5lyO TT޽n vI u{E }M#guCE8[%R`߆S ծ|ݪEL-H u!A748q%\mRLy A_2'߀!)=2l`RI qc%LWM\{J;,JXβjre1<$ӮqtS1pu5ċ/cw (( PY).ZZ[Ѕ>P婳W9m(Xb#p5s.ng9SzW0B}pk_w5X9+nu߹^ E7#Yߊ6i;`(LҔRb)h*Zt |>m*ġBaKs^mpR~ZiiMK`ZRm^LIZVmǺZst8X$e.ٌQ!jAy°ʷihIs]?Nڄ՟,i&&Vt>QVETnDb; fN{F%Qގ|ꏔ q@ae~"dSv&U#~c(]tj拓3y䃘;b t= Lns6()4TJt\br.==v[> \CHZE ! m;99A`S[ꏾScJпo.ɥ Vdu5>l\=͘1Wpl`rtKrM/ҶKH8l]uN*͇4jtNJ.C:*#)2$liѱ$jItm!L\͜8,3r)9gSW;_6 XT{0IG5*32 2Ԉy󒜸7'62+Ktj&FH ;e3Y0]ZvgDl}OO.B w*r&^nė\$V a'B/{/qU#)|GH_H?t#+g>M@_@׎yp?0|*혯8'b ]O&$4ԏNNϘ\(>M!OOZdxW:-Q9 Vfb1{q4tY1Q`ݫOr膈ϯ\!Z乜_ru-9qu|iBX\MYcB13qģ2=q!B1y˭BK`q\CK:"h$|ʎ2K+^.`}%P ]:HtM@s䟨k7 I-'Xk 9WfBbw~Ҷ E~.h!eX.o> W_q}go,oT=R|\bӔ!$2h09)N1 .WR{{IeΥO@NF ioͿw'Pm:xGlɴV]}6%X\՛+/:DلTpwG6H"4)`/0?M/P_(@ ď)> P ^( w\aצ v@ KMM`5(;L籧Lqj1D?{4}3Ց\6S] ] gw0³$M^({.<3F^je}Bga!3 mtBmmJ牼G"Kg OĈ''>i1lpW8^>yV S:̸u]Dax Y@%fo-ZO/5^QW&4ސloG{ ^UPE2C5XQžy XcEjT[|O,l[laݪVIpUߪL@dx/Njo_̛͡$a[&(-q~~:]U,5:ʬBݣ(U/Ѐ?3lI ?. s&o(X:zl+(R8XKW_)xCIILvto}B9f^ k\.L;ERmvS 8*ܮ긗.^>g3gg&ٔ%K4Ġ z&X+kd>k7o/B)%JѳW7D&; Kg|0$&0t4WnIYȁ@w.W/X*:is*%-[vQgy8 }mqPXfc}QV}`1$Iݸ˳h]42z4*dGN֚?Ν ~O zmʠ3G,kiGߧ? ((v( ҙ4e 'f2VJ0q2PbJZ, XO{"P #68O̰dUs îL{|ь<]*GCT2]iW_|Vys=AiM c@#_^`0BgB_y5hggjBv :T;'7[U@:gMo2N)N'pK"Wpv~j 3辁t]bGag$Cƹ4ͪ$g{}9G|Td:1^-1cLx,݄.Ί]lfӇ?-z7uRi3~|׷|kSq#TԱ_ĥ$SW,L`kEO:oկt[?ʴ,MMɂ{"Fv.Yr0E}r.SCԈX b2/6kӘ;_J LXL_ e,ap5w ۼ/c3b0j‘*HD( z wXt[E60/jEJnXl0Eyfv"$" Dxm6[7 DP23əF?%IӶ _ g&;IfklvO_=:r꧹!D`G;鏐-)r<^K?]WJp[d)FqYrȧ"0gx,VٓijIh2Vo*S3娹rb" R!jf%7-3jT 8>ױ|eBR':3!U[ }l.%0)z>G.w.䔤t}wQh}*^]u%ҷRܰj41-L®{>ZJ䒓ahx]i_L솄 h ̎֏Wg ks|"x޺ei>Fedx8&MU~qQ.%Vgs"?G{pGMej)dl gΗȆ8h<׶.I[]=cdr R"y/;+ ic=d .`x}8;`T2d843ȴ̌-wyA1i卖yr?ʱXq_yvۥ͸9i$)pm`Q*}xלlG@snY6V4 gʝeBb#9!&0WYbj"I2YZn4<«|Khm^[ԸFAvwHXݨުIAJ66բH;IVJ˙[H*Ą( leg4|sV,"D2Yb\׶9QIc|kՖZ>>)ݗH/YetaX=<_]}N_Xa>Q{6UOH G;ϒFZG/__\;V;&'ɦPEW}/(_D7)⽪ԭz5A,G"A '>MY^fIy> I7*|zz-G .j!npN+[wbZ.l7&繅2j pl!MqU6\)Zy׈uJS 8}AL-R׏m{|9S z-߾ *,"6>qè>2n)gFh~T\RK/kU(V4_^ `$OK\g<ȅIecxMsTFbmVQfv?22*..B:Js чn+L O㹊 T|mq瘇S[(-NLWu¦xti({[OphU*Vt{QM7;M96Xd%MP6ױ%SJfD sٕ\ӼJ2r PpwHѪs&-ܦm²ڃO'vg6oQ О + .7n[aF8Uҕv< -[2 Ұ=yǷj8?K tt)2ǔoA9]ΓiP6gi##~6/I%(uu`I|Q3lƓ|"mkI-`4`"96BR8O:oN(ܚYJ=ҮuVG ޶7+'pe!Up#,pj l?%.^\Q 8!Sȼ= ?zfIk3va6I6ͷSMZzO_;N=(ׂ1Kz^2K6Dvp/mпb̭̩+adfcU7Ι럯߷'|&vM`k*n| t6=NJ? zi%~SoiЌN]?0jZI(cV_i-ល-Dk mG~:.o͂M4l2&U־aN1fQa9 HĒB$Β&'Za_R&$Aa~ʯ{S:?u!|A$MAxwޥJnH_ lu-AJ\W8 K@q 4e=Hp5 .z+P"/ .d q'5O$:w~}w%ߗ&=vMl{(U'uw_ `5N^sn]|@O6A;\ffb0PgIbJܒCh:?FD3EaDYLv)q`v:_Hб灡ŰR"z|.Iޒϡ 7nVBšȧCﭜ2ם1Rn|/]vaEmb追"!CЁՄ.g(wpc:\QJyN69êrý\Zyk̨\8UV0ݵ'jpo֤} þp|?JaGQ06Aoח q=})s&m3zҀyxq " O},={8t!Z7eĵQ)VI]Mn9RCdq p"p$W({gHTtI{BUsOg~!ҋ 犨i-}D9b.FK EtĻ]rq )-h5Iu#oB v]vc8۹5WIUQ#^,=w,wWmy zvrSA1,c:Ԫ$Mf&ΰ d@-j\W אhӰin.B'&BxL w54e q%2i! a/6ΔǿKdeЁ27huh-8'H~7nibj_I %!9)HGtac2̡4!"BH٧,<&/aO߆%Qׅ֯?@I<lyF=2SK9uB@a[4W'rŎ|!!Յ5UQHWܵPJkdv#L;>H҂ۚ=2hR,em|7lR\tn [Ҧo|{/3l#P M%ڐ6E^Uz^R93#e/RQ)ZS@NnF%e> ش SYz4ז Zg5}0՘ICvq)pR֖V[Q4HX*G}ڑPߣ !aBA?2psݝW*$5< lK ؀yK^,p:K58$BSȪgWUa@29&viz&m朡F`-#MϿ]|~OG#0/{fpApC\ޖlJ %-7 ?Bs1KwLWU~?5%->+*mW|h8/LOH̗7<_Vtuћ:)ФB wck/taaΓR|b'BK,u=1UB:a$74nrF$E{k9 .(vʹT&o9An{P~y(@d 'OIB}-=J)YTa :Eneh&jb>Av0.w8F4QnYyZZ6].0@NCr$I'!W[ >l_KM3_ -ó{~ PKkz\!{*yZTt7p+u/daT Eite*Os|´ o!&ož&]ZT2 #~i5+,%@mZ9 xH!\66ulnO6,̭:buv6sW<{1F8On|ru0B槁2N7ĝo}6]כBu<:d~;U:e^ a3b-BBWcEJ%eF0EٶpSZ?ѐmv8"f9ea+ P\vڂ,xo_,h(n@4mQ@IwEyWLh5 (z*c Z5lòU_Cmƪx}!zAODԈhWϏ&>6ʼ]+ӡX{ӹufbBT/>Ѹ|v-J:[VW(I 8C YEv)qzRnAsON%}U4mz6ԴR>ez+V,b*ݑ-RXt>G}f"mpP%#^uùH0`sZT NN|$.>7^|hRZE WP^. 0]{./UbqD9Z  ^l-, g[n-˦(w3p" =# Iv!1TvQf;~n^m!V7-NG|ךqr}Q7Pӊj|yU։眴xO)+yT|V%gͽX$wI~:VQ4'Jck?GĖz 6)O6AD\aD$]c:hB;-LErt't s]U'+lc%HX3;&Ƣ$WG^7Qҁ2xjWG_r}Wx~C) >EdM&?;=[Cbq[&&pphk%++XH$(B|wwWo0fPzz<;>f#'A" [*̴&)VCVӧQIDw*WJzP#0X6ݮ񩫛!hj2aJvr[]p[quy܄C"v&U8 vN6!LSXnE!CȗbX5Z]WȚQFƅ)e~)Xhʌ)%tfW(GUSfNG0>GhydTG*!S e_%İѥ2:B1FFA9VfۇkVƖQVU9/lSl7KP'3uuC`D˅9([ OX47qe1:L}!S`_?Gy<+(rEGyP>(ﯣ|>/5glO|@H(_B9ZRZXEbhwggs\T'XƋ a_pىҾH ռG/xj#Ouñ GǨ/7;gf.ۄ>W:] 10p#PE.N0EZ]T(Ow~eJӽt'jn=+$Q6.n,ր \RX,-57J &t._⦂BW̟cǠˊѱ&Rq 2c">WU}X@5˄{ cLǢ2\ks-)ĪdүP&`QDKqG" zJ><`Aa19 ::ȨXGqA ~bmqQޠ q.pY Ȝ!; eٍPHUț!ك| JYnVK[h-yفaHg: \ $dHcI^rn&?A#T%&%:I:j稒̫IJ+ OwN\ >";U)Uk@L;Ԛތulq{Ayb:c,;*%Da_h sՅtZaq4bR8J}P N(.">' )]2K-JnzNN77oS"Q]h\6'U$.[Z@Xn0>$4g~Hұ%3˃3:VSɺgMŀ7yf!C`׳ƀ[e![A{IVZDN%c8TUGaAM;rt˪f($'0mԺT!_k\Sryo(Қ8ZN< ah]D*h Pє' vc!DSm^vrE/1Ql;aʪq܏Ǜ_OVz2yu?;7EI?:WCC`߀q/0^0>ރq(_P]Ap^Dkq[U 5I2 endstream endobj 10 0 obj <> endobj 13 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <> endobj 29 0 obj <> endobj 30 0 obj <>stream HVXTl).M]RT"E,EA: QcÀQԧ>1Ԩc5ޢw)R|b|/ |o=wΜ?眹wAbdH,Cnsh8@3Pz7 `63rKclGҌis뻀̴ӝ\2ؼO{fnԠ}|LKI'5!|ιSif Hܴ8cy7И\5iK78?_@2(`(WrE==F:5W2+ #Ƙ`hb)S?Afeq\({fsLP[XZikNeckgŵCGNZuu^}|w =GpHhϰ^' N2tG5zc%%c|JjZzFfV܉y &Y4e3f5kΛ`awJJdiٲ+r꿯)_޺oظiTl۾Ýv$Ux'>ß9zN9{._*][|yWo\sx5)h6-'#;1lDXQvYF/#'_gAp4NP!L-D -BSP۩۫5jzzziv[EI $kҴLҪELl#D{I >b71LEbqQ)CIxE#~ Ӆt)t݄zV|ʌƦz ;sKd$qkGA0BZo/e-m8gsITZ-s9iz?%x0g* ?57xPƪƒo.~]P}wu+[TkS]Vס&fZNUի7UYՓMxM`!e3 Acp5H[W{sc*oׯ^zNwYqt.ZQLæ }Ŝ&aGqU\^aW،XV`B,A)a;a~Bj," ؁G`v`7#eH, ..[>U| e';F& 9 $& Q)xi01ڷߣ %9Y74%YQjg05#lȖȞ=99 R FH 5iHK$<ȓ3y~M.Gԕ(Qw L!J=Q{F7pK(")?   XxJHCh()44F(Mc K(iώp_2+sx(Ȍ_`4_5G<dzVNS>)9+D\b[`QΫ%ڒX: M)*84RK 24xBv|x [OSxTi&^&[2F20Z1*ḟx"֍ 5VX؀jYڋAVi3絹͢wS [KAݻtݵɭcWg'v6vmXYZ)r>$9Eʖ#hmV%Hq~l]Z.[U$Ox$U j>-]rVJL俁翘d!UR%p;0bqdʥI9if4mx[Q29"R}%Iph&yz U\k97Hd'C,5)qlmTjAo J+mD*-j5_IѽɤJ<M$[ /M6ǀ#v G5i_!K OP*T-Y_^Qg|{{j-gg+^0gǡ &WQb Er QzJUD-U.Ai!R P(\AM@4͝MTwfg~ mttݶd*Fi"ɭVY. v ߒiPYѺL vdK6wDA _W46q.V?[fZmċ=e+g '6t5f[z"ӹW7E잩A[͍ीgIϺLW$ VV4T#\W4&k3պ6E~̸qYIK&f%>V^A[nԨ!zdCC*!P^R pܔ6L 2X`wcjbwt$5867b>=ܪ- @Py7T*sc=0 B\_Ek+]i7=DBOA]%EFH0|BS *K􊙓N] <9"*N)mIr(TAt AtiT[ϡ:wt)y(;T-]#T#*Ĉwd35@DW8T95).2q,䵕(;)gN‹:pEᏣNt!:K|GDZ}*~$l`8ԣfTzu/j7i}= 0 !ENE.JxCyԀN)#^JK3J]%r3;ڒТm):$(NXl9qwc)v]_jԅ7F<I|p2Z GQ=kqt56$eARj"x@(zC‡!׫ 8}\4g^YJ4),\79^ T+UfJU J d1#ڂXt4Euau@(F{NRl=5{8_ X-;k/'1h `%# -3@HμS}ӜX.<)Q(E%"_qj?3cYAй耢!>݃@Aу) }Q'F8r5`R@kiBmqJiD";]dLzr2M͡ _ hQ2끾(^V =auc:~">~BZ;فv;^pwC@ mNf|;C"7SL**rFc,!+uvndᖸdGO ?s{~Qk36 wa*A0-)yԌHn_%0>4õz 1`&: ?xө׏b?|q[qČ3q399.#0N"O!ǻT?k)<}O)aY<8Tr'ԫ8XEi%ƊXlgO,y,/_9:>++]O8 : uN.LK#7PIz$o+[@{Ѕ5ǡW%x6B.<7(9EfBE3WRPU1?w"sS@ !Wʼn%d-0`/4RX-iu65ib_0 $z?}nK{ ޾h1dW۶i3~GuU޻o&Bi@X~S` Y6BBSHZ)HÌt:ȀB I P:CũK*V 8@aboc uTq$o={{ι7?$@oaIQ4R\uziq>U?cW"~HUfǎG\=k+{OCn/0}cb'/%6.%̋iюOvDj[i6F2ߠl -Vg(Vi0oT` 0| LVg_yF]Ci> q* \ ވv*)U*w5o ZIY6 2li_-v8LCgEpNxoI٠9hgkIP= {xt9\SzqG)G:z{|/JkN1о룏0f`߼=~iӧ!S7}]@4*#@<ח(5Ѿ?I#]YLo߁|uJi̵H;xyE8kFnt}U5:/m0p Y=+ib{u;A]ISy5D[r~3_kll~糧rqLM pqOw<cx{1kȳp(^o> {Oc |jV`2H}Z, C݂57#C!9n].,7/i`zm$3[[Ι27 9{El=@{Qo)ф=Ph1=uЏmUQǹG ,S"8'zRWr0pP:7rg}=N-s! 5s]q?q>K [s\žF=ۨրnuM\P`Wi"]>g1EuWH'ۊ:>k1'P+,s`$CT(e,ٿ?Gڸ89qja,G2e@wW1k::i8/e2j.>NW q\#}{->=^ A_Y oqn*]8٩.Z slu#^'^:vZD.߱O 2ؗڕ߉w^='Kl}c1ݓv7pE\昁x2vkC.d|ns&@ w̷cQeFm9C{$CET5}9ߝc9}?0v~/7,JPrPޗ0P6s*(|7%]w') @ wyJҠ\S]v^#sGߣ[nudZ@:FT UeҸRf?4@+ YIYDmV;BW)Uy/ouxV7Z575+)[S(f#%[+zBk/Ys"P'yJu>fC!)1Z며V8_Pz}(. xY?< $gy*B⒈5? Ac,RKj1u+Sp93G%69>φﺃ,K4tCeJ)jl RJ0~=@Djւ0‚9ˠC_4"\ԩu3,(Mh[T]W]%G[,-5cWJ"ЏWzYHΖ?L<_e<>[*blBOX4w9-z;-v&;Vuc[Jsh&z)л-_-aZ~X)3odW Yy/ ,U(Yha*7z0z6, ;jﱅYc5 `oa֫ToWoXN =qR|>BG/t(P/t <ǚRS&ͦ[Mꑣ2(GVtR/g\4|KkzFK}3=o~f6obT1kw1vKw2չe];Sro;k*ST`K̬z*qq ]5<)|VbNӗԥթھfle' !X(VC2$ ! #̸  ÔϳuA4ͽ=4)=7µeUPQ ~u$È>7WLX&}%%PߧZeOնziK+nHT 5YWdJkjJ,,Ȋ]R( ? $WQUbI;TDXt$Ca#`IcjebY1~s8"Ne✐0`:%qv*,LQu)_cs?_B`YV_sG_  endstream endobj 28 0 obj <> endobj 31 0 obj <>stream HWkPU>^ >sA@Q^AW 7Q LH4aRGh2:m:-D3&h34q:ĈI:(M~phmg?z|wzg_=/)kP>!On50u7C9~:[?ԺW)e'[>+?J>*y-D=9^ [^xs976֟t*Z@7oo\S4_, S?}㖭VxOձ6)b <)Z?&K{&ĞP:{Q2{O[&"0J[K¢Il9-( k)eAo2j2ʌbSN4w0j z‹BIcls(ʏn C@#Tre.5Z?"(I /* %yV ˔tGT'M&rKM0()PW wtu%u9q/"UʣR+:Tד^̓ jMb +kȗh' N^Z*%X _FVEލn~t1S)ȕIZ g qngbƜUWJW X*|] 5%BӬcغyU yҏbu pں–WV> Bi?]By Y]$ m琦MHYʆ> $BvR#0y3nң<ؽ ^&9M=V7϶GJ|z ج#NlC ]Ǽvpf]Op:{G{u^%Sժ~p0g2wn~%^w#Ϸ\MWX,zMSpdWIHG*b#?\~vN7\|WwE5﯋rw/3|'Ϥmq$1b?n>v?zG-Qqbk?:C&?hlljs}lR(4p3 endstream endobj 26 0 obj [32 0 R] endobj 27 0 obj <>stream H\_0Gyy$j~iGXo1Gfaxw}744'7K׷q]R]3[=F/>=ﳻm6"/e;kZ7uUٝ^E|z㧻~nE.o9c׻kS4Ccݸ.$ي?YF|Sخ$6P=t$@ZB!P)JCY SHB žk|ˠ—ɩəS KF{ ruyHRP @)t;@td$DGSRN1 n[ߟ!$Atk"bwmHґ%$%$͡ ®[nPq,,n+%vĮ܄PbJnB_ə/ZRTzlYga?k4! ow_ 0 _| H endstream endobj 32 0 obj <> endobj 33 0 obj <> endobj 34 0 obj <> endobj 35 0 obj <>stream HdMe˚@ r endstream endobj 36 0 obj <>stream H|V}l;Ć%q 9;͇珄`'&$f!| $@)C4ƺNZ`cP t-؊j#Phfl6罻$:=!Zju9'~ %vdA;BWEOyokb##F#DAh݇cÃC%Z2 1|_/|z6过g5DWJ~ G+]}vW6w`x_a)0yQ!I%J'1ڎ?RoD!sD/"rJu1TR^9܅wXW Oc:H'!P8҄"D4q(4o#\Ͳ-1<*Тmi;ʎ  sQC]pcMQJs8vĎB3 {d {D ` /)1<ML@d6-ˡHrdF- Rx۽NƬ̪JhdIV"&S EgM͙ G5ѷ`X--q<8 pf 8i 0 ^T5Dh8jEhMmYgp )?U2_1UW+BN/}k ubAl&hɂEJnwʶaAl"~I0 Ll`&6Ԙ*:&Ď(LF+Nt9NA)ȺGI@Z[ufѫ *| x'uEXN9{@8|t/7}!|*=0)e".c1 _J'S8V,dYTd@%Yz rvIo$މmx}lu*a>8wG<^k2䑁%P.ͦR;:=$uht)krv6+tZ,GRQS;cmzP1evR>&QTVHZխR.ŕ2 X>kU.?Yu]b# :(+-,]kWuF%/},:f{xa>}l`H3iS*œK'u?ZϸD`Ӧ@}6OaIVw֕y6Yn:T'AQ*o2$ɒyCy˖[PdMD;n 0">7ڞ •[Ŝ8}1MMNolZ4 ][n&*/w`:b]zXmN*-jV+HU2##R@ R#VrMp;r-:bYKicc+r]_Fy>a2 N\ox*əoп%w/íʐLF4d L۱L/ @yngohmsu/',+1-F7Dx|Giq-}i`<*YW=z,h4/>YC|;)tѧ fŬ~On]jPi^R7ei2-45ާ'v(ocΆЊ/O75RILzSYw|ar \\~c _ޗ䓃0Qq7o.8z 333¯(_Î 3c,| |P"G*nmu[:.[Wu䵆 vZHٶHSᱝפeYѿAE~^:!ndP ' /SOR&'8z "PK~TˑA8dI-q31t^1ߓWnUNarZpG Z:CS[LKCFhئ+~}vHBcJc7'1!q&@Cץ(e54EB&L e,mPi*K*DXOQ mRQ{ώMO?s=n gc/f)˟U^v Y4]uɊ׼fniOk6#0L11-[`3rUYT9עxϨEĨ78i&]:f^խZ1bEקg|쨔RUl4T>2n66T땽mm]pm˄Xms|X,H'&-zYZ/1*8 O w& ]ށ]HpS#Y+A`pؿ5O#ԾIfKM)'qh8j$qRul,R1MW3;29ߟyQznY3ٟ\{7V՟<7m?u$Slpz)'1R8,VYx.soȜ@M֢w7厂w9[{D߰yP{jk tue]ˎwukqy 2]8F%x˶3So4)gj=lդ9,1y|N#vՐtu7_XI/iyɳ=iY),C*^U%OiTuk3/_GK #v(iݟ^zͳ!|$2ptLLb ʑ0sF B,ƣL:('M\.L\ۇ2&cQb|hۛ&FzjO5]#=ؼiu"uս\SDӏu=I0'xl[n1OI~G1"fFGWE9on]byc,ȣ ᕉZf5.f~^ l! ?R"rgo _,Wvչ[r(BI˅+t^샽@)~ HCNKw';¹%%O\M0y92.T՗av8zB7_;ߩLB BatvI'}H)?8)^n"f؁< pki7iRN8CԆt4 dB~[6E{I *s0%I'u>>NԲK$S'9 bX&d6h:74j6pf;kۀZȇƮa,HD $m046H&c c}XE;)`mՁ^M+?CggtF0`Ni7;C=ΈH;U۰{N6Cjz R!Ա{\YB޷M0cXNcb7p`,,%$NAUlGBlRt8&N;yFiay[KB7/zG_GaǜA`8uMaA*jˏY)r!u W&fw'b7h#XadcW>*sq yI r'~\~ Oh1iO+ |GJz>Kzfb~S<_mm4PաZ)P_QTȢ@B5XqrFD,0O`aA ]`@ 0t`!}biv ysp6&bx3.d'ޞQ䣩xb+]Q]|(7%$/˧ӊVWm+?Vm;ЏU/U/HBѱZPڀtZ(m5zJ DF5 וb J?)mRUE>stream H\j }ܽXO)]lB.C>I*4*\;e >Μ{߽=Qz0 PZ+W1N~[Ν-*$.ophW赙GhdPנpF/½G۩S밝W9"r># ^ YѩzS34~\(߫JΞF*HI;%$j"y+8}NK[4zO&c=6x[ȵ_+} endstream endobj 37 0 obj <> endobj 38 0 obj <> endobj 39 0 obj <> endobj 40 0 obj <>stream Hj`@ endstream endobj 41 0 obj <>stream HW}lS?> %uN<`8/P !Χ@3FPՠ,]UӱyӆTbFфTN&d~R&?曟{{ߍ DfHv{\ `$tHȇl1vA&}}IľO$^{]5PL\kFB~}".(}_߈2a/GBC.dl"4vB*њ0^E"' <&{: zFzGdE"If (- Ƅv6_X^b51v/ɴ@Tּ@i>!q|Fb$iA`ePe֨X/YiYi4ـ]R~K0?@`g6C!`/k?:5G=ހb}E8RGsSa=HjK?1G)0;dKtfv<<4y.>IGSܣXܴ ԡb "[gʚM(FboqHS(vɏ͋g JL=|]O.jh%퇯cWi{b͉ (V=Oz)6frQsf*FRU +9iY߫eϞZ-^=lSlkXƐQ'."Sv(U/BVlc)Ć5z tŞJm-meBimT[WoirJwnYcў/~տf;8~8G;-\+ˇ^*)b{ K3717!:+Z,EZOӣ4ijF=C-LʳM]~>W'_ԤYƐ~U.B@DɬNK̫j=ށUGwZIBAf/UO9Wd[jWD7$ħyr؟UھXGɶd[Sa3ޠsvIe>Ucڣ<s EohOwV6RvkMӫ{LJ‹v@2~ck5o׸_)TOa) J4.:ZV ]ҸMk< 8 o|pdLON I:gyUee])TIi"48hmnYX88훈>stream H\j0yY T)}\m·oLd $q si<5Z9v-:蕖iAi p;W:;O(~xqvvC%YV_u{.腛W>"`;5ʭ'\ B8a$q6\z@R0J() jOOXuv8"]=DJvJ#i:R(Z> endobj 43 0 obj <> endobj 44 0 obj <> endobj 45 0 obj <>stream Hj`@ $X  endstream endobj 46 0 obj <>stream H|VmlS~9_c^_Ďcq4) B2" -(m*Z?Nb&֩ҢiҪCU[ !e=N t,ғsY`в}4T,z>@LqӞ h[=8˟OGpٗ~0!/6_7dD 3_lQ{?4&P{}(0L,=F~秎6(Σp Z9m |FV4x<1 P*B˳K+~'桓Qr?Eq@O̓RO nH׋5\C}2#*ā 8' MΉɂ&05O_I{m:o@ ѨݩH8!&\-˥7mU4k5fd䕝APc0( )5 \Dqfn;Re߈XK/^n 7T,ZP6wbA;jJ}S{֓ߝPm yfâ;=M[wvL Ej~Uv[WfԜoŌQo=ꕟ:ŕz /3ߑj{ȣ<ͶI|!ͩ{l(q^ A]Uڤj$ևZyH8ܡ_PXS[Q:jWM/a=tG{,c3 &Q_]T`˻Pcc44޴)J>gƮrEZt &)$Zq֎M% pH^EZmm֎5ݴ̽80|:GZ2MAVK5>`[, ޔ o";b#/ Jm 5z9ŖPcTKjZn`2{Bj/q O$1[1}QCj|jۇ`$UP8Nx7`q=̟|l$ɨ)2#ѷ!JL`u -ۺ{Ugc'oJ`(`"֛ޘm03}lsr,p,6Q :d3k"=(q]jUP8ԑ&NzM^*RMS` tv4FFNlz 뜑{JNgZşy_ cZU er'y)l E-(ϟP# ;@ɚ/VY=L, *.P'KxKp}R{DKƨކl'xoOx\458ͼ7(}fTl%NYWw5˹4pvgLjW 7'ypf%ƕ;?DVeQ7Tqu v,"C] 9h$9# ˆ"F$ADSe=gc ^; ֥,$3Dīh_C3BЫg8oKďG oIbYP둡{$m}\;!>r?j}6 D/CQD"1*2DT(bsױ)R!bܑ?Nl_KJUӻޏ;;?ߏu"M㈹utl9~}ך$vZYS^AwoYK?GoMt[ג8Y?dӸd|2kҋ~5j)|t%},H5klZtFpp4| q[bG"Lߪj|2E[BTBk2BQ9:O]yfKhe ܻL endstream endobj 20 0 obj [47 0 R] endobj 21 0 obj <>stream H\[k@@+}(:8 a/lv@1bC9Cwis>uCsYdߧk{ 8C7}jx oJt};'i\empkX6.Wٷ S?_Ydq.aE.6хr/D{9t~,} BEȴ.SV|mz60tEOSyEN{;)RyEEZaNo:{ =2xJ]h(hh(hh(hƥZR1yKECZm*4.iXtuJT?&b[ض)o4+sZųHyo5{Jǚ|}[_#|CčQ,G=V}< endstream endobj 47 0 obj <> endobj 48 0 obj <> endobj 49 0 obj <> endobj 50 0 obj <>stream HzIg#u &= 6 endstream endobj 51 0 obj <>stream H|V L[>^?0-&<ÀcH- $vCZH@RH`ݺɢ%[GP*KNIT6uYDUEt)FQIe߹ys?9?$2IxWd% <{Aynd*3\v{ܛlztxpܼ}G1b+>_⻯H<;xw!n˫BB C%_;߻x{%B~%#DI蕿Bzx%G*b{1_WoדsKaBTsJ?{.wV2[D'k"E+;J_ FKҘwhB XcÕcjD/74yKSO4L[ M"_qcx:h7Io` }c>ׂGx2t ;c ;e,!ey!uF}17 Ů@b )}0Ӭf(Ko \tg6'ӈ#֏ P@}l3y?B'[f f#tnMy[o`1/H$ vpt`r2.EXUwOʅS*].'DGv] Z (L4:k"h6#! -߁m\Zp.Unw86]<.2IWwM~ݷWWw]m?>s*yzdҥ_ly dsKWI}A#(j )`x8|\wmЫV%RS}yڜv9e>w' oxmfv[5xr,y6ANeGϲGѩ̦"wUr `h^̤/0p 1h$(U6lʓq\}ε:[+]X}{qTW]|} 'PWɊ0+Y3 uؕOe7_; > e_HGUF\CPw׳%ZL/Nm-[78VG+gLU{.i~h_qO}뛶4KΆnʱV`lt&h+M(ČFDmtyM66(*K }^`9DغhY͝0_N8A;AL'p'p'p'p'p'p'Q'YU)eCʫ|GïZ s|T4e{ ͶsXcdc>kjuֵ,^kcjX˘ ZJeRW]Ijy11f$7ztӡj7G7NlԼqlh):4ⷨ&hh!wǏLutw;9 {o:kmʉAna'#LY/ $Ʒ lQpKR>I߇}+լj (V52t\qHj/֛EG ܽgbz>'ͥc 9NB:p_GH')1z #iw.FyL7'%zs2H~l(Nʀ hx4*b-ݱ&E]?㿡 ZC51c/~ç/-%a d>Ѧ()kM>Cf^k+?o 6=[0# +!~i`maK}e2)&s}6w-ϖڢy/KRO[Ƀj%G'Ww^^ 9XPԅ=&}J=ō%*T&%K-$|ƫ)ՔjJ]ՔjJ QMDTS")ՔjJD5%QMjJD5%F)9B Q=xHfD~k9-e4nV2?lr);(Z>CF>Ɏl[g)-[lڲ\~/rlo.Uh5Hƫϭ{]%$jj2.o=KN,|WqSt{ON!3irRjZ-&sYs fe{gXXġ`v;R;q* \ˍ><fwhtYG`2@T<@)HD R@")HD R)HHZ_]#klҼ- idz]1NSk#s[Iw(=ė2QWKR@"%D.!r K\B"%D.!r K\BR>r KE$PB7!J:9fuRnҖڎl7f˙3<۫f`C dFAE{>^J,ge=L=ۗOC#)FC/H\z) R8big/c7F޸8d9Ljt\z(C׿ٚ:ҙ^`h[Zj:;Wk(;re@h(iї\dVyҞC!j5m+Wrm׆%+/_[z/sR#Ux}T0lv v)-frV{d!8*\@P>zW!ؘj?6gXO[8uRMs>qьN$D:~+Ŧz=Ɗ͋;&V'WrbHI.j/چۻѱeCa#?YtQzќp q|IQDGQBͮ$1!9pbēR}lo]Bn4|CZJZ&jxѥ~ػ?3اɼTc9Bz|Hrtg7:}9-kO4_5ȍ|G/ EȄhbOXa#*z#JG˪^ %ef+/1r'SLjk9Ci 9w|}!{g3kʠm^i(פt݊w&aލ@3hoMƴ۩kP? 7Qs +ƨ$|kkC)e8hZe8hZ(=CccmMꙈH$g"Ꙉz&g"Ꙉz&g"Ꙉz&뙈"%"0k׳N}wv杹PhwC=ݓD=Lv{͕dres<յX= IVR+%i #='}ȑ0bJ31*և^{zi?R&v;ч8O/f6WA!!fXř=q4W.Ǹ/,13}`4ڹMܔIs?hnͱT}"+܃===Z V@PjT+Z V@PjT+yB7r]T{|J"˜VoM ZZr?56Ǿ:X!6 j M|}uhЧJmḿ2WdHQЪyy.i,?O 8 IFo§҂O4y"7o {>Y2OVn˿c/k]m\3{Aԑgye^k^,G035(w(_juh8& !@mD{[uˬ'JsP(MY#)|G)lT h164ۓq(߶KEnH3BKw_X*U<RywOFd2mmkwBNTTj,ܩj& ԜT^ rPJhA{:tZ@I~Ww$uy(!Js6l3q}xKI8J6Uq{#֦PcM#wKIz*>u|w#kmFῤWIlErv.3\fnmDR\DjdʲIdGU:lp]n#6HsR譧Ǣz0z) 4܊3HR8?\}JqvϲtZWc\l!%ilqPFv_W32H9s[ؚ(p(mDAp@X2:,Vr.)esi;Υ2Z)mu\&HY NƝlCGvUXﯡFYufޖo{fC4(7T@;ON*ap~[ =%_!-GIO&b5>xմ}rmI湭'0 `tLIpzCr ^ ?4h* p_ABt1Ȗn׆S ;^'F>!lk OS9YlF]z|@\x,ψ"Fjӕؑ˜m6F81Q*{~[6̆G6A;7d&@D>G`ZOtWtP MNv5*,@ [@ucݩo̯R.I RH,'I+vZ?ڑA݊:hq3vI4'cIf8p Cvkm =hG6*f_atڈd N,Vep aJuJb:q >?2 a'[iǤV0>VPTTGn:k c.NrZ=UvUcgJ+-k7^?Ġzho.n]j.o D.b3 fys, a_JH YeL|`|N{ylDSjEi!.&}1> f_#?eb);,w8c D0_I1աdaiT/i|$+,jq㬢^{m׌=wO{w쮻$%RMmBUP(RHBPTUQAQT (BP  UknIiA(ffc}|srx*|ͷKuBD/ͮOsAKrč1^*-B+f `BoŬ֠dT E$7Ý*0 f:CƋ=!W %KJ*SRjtpȘz/0..vBsϭ.|ՕD]jvesGYqytg ׉oٮ{Xe2Vo H{#e:s"=`p ${U,nU^!h'EI BX>¢+-WrM'DNp c>"; 9zQLhNsA'p"I#> >ì5.E|qq=?a},,>"/̈? x۠ pYAaVG:fnxS֐YdTC rn)X}&͞'y\c܈TKOOOQϙ2°DK3rծt] Q5ͭS({1'`M[1ОgO@oDPU'ސ`}x1Rb<=z8Gr켚6Ic@4 2Wl-g+o=?:'oN8>3|!"N[ DGdqEdiL bˈ( zej$Lo2$&I|?Sts@'s ޔ{(Ǧokʩ^2)'U!3:mJNaI:89^~sqvl@mC`UU:Zl(Is`n\I JɹEuFjD&W^ $+m~髊|ōi[6eqg r``LI9v{4iR}seتVbZj%Ol,w iۃm 8&׺-[Uۨ,(.?~o0u`T`zM,4ԃETi9"X.Lf/LMnկhzJM)Np<UBX%ǃ0~Lm5Tƍ:鑅6A /俧tt#_P y[ۻtm/2_FfS{΍-W8D~vvk].}cz#$Y3diOJ%zvBç]+zB:A_DYYx"҈oI ;JXCƙeQY? kThȞ{^@kMdwi>A.v&F&J%g;߬ۻIbhn}VJ5;$ץZ'w`pϓ tv_;{="`8g=bWifBD>ɉ|X*!6Wdz|.Ͳ˦͟u)^!؄x9ƕi*P}?k1 Jv/ګ5m _"rdO-QEɲlvb9N6H ]*lغ (bHa(`X`5EmPn hmiK%q?}}(DyZ?tyʡ]Byx!vO]o6O,F{j5r&xlDvtw "4!eMj%GQ-tyMݓG =e&V_ouCOqcʼn; c[{?>05L5*?GL\5fxa@[Ms"=g V^5[KˑknF< I&ꃆ3G*W}kG{DizⓩR+k%%Fg\8lঝ8Cѧkʃ4C(宝oQkEcknw'C8(ǻ{HAeYDl2 ] oyRGh4\`Btn]*>Ylry쒢D#W8Vx&mߗCK ,u *E;QSN&9/_#m`Zgш&mP iSeeG __ B_E塭_lw]9P"1m 7!4hC Œt-Kx! )3n蓮MSΚ_'_:/ J>`MTMOi:q`^#rvkȫ[:AwjB [1_ a`8H?takag3P¶[fJP}ҢExp-oK+GRBUTAIZމBkjFJ̜ uLĝ[T}<+Gѧd;gFX)IKξ[P&Z2MT#Q6%>_C_+DEY0jnھ $@~ =R6⏸P,c縈(|.˓\^:Uo<7^齤 FL>P58X́@19sBe?̵7[:KS{}e'o^FSh7n QP\ȁ[aòp}UJ/d>1 -Z /Dzr>Im-uuJJ\1-:#ͪFhsF-0kO5fy_|ASa5ʠlEYv Ca `E$MR5E-s1>uLιJvlnIקkTę3F;tۗfmc#yMUYdtMXPh2oVfꋻl_.tJ_ۯ򻈁U-2Ͷ(A:V4pČbr:\VhE_RM s0IHʲkPl5Wlm C&+(ǬEG"I"JI5.H2!*jMu/ϖ -B$Jޛ, }M[LQɞ!`v}\{_YtYska &Xoym& ICy~xdyGdhjj!ML2Lj_xNav.uuUi]Ԃxuktܕ5Ul VG^נwP28~[;h)NgV|&!~,(gՆDtG&TQPUAT#8FDf$'bCkU3\Z5WUWyvZyx ɕaʙipuܞ)ǚyi[_AǬb9= 5[ґDlgwWu\iux޲XUraޢz=s8CdLHPj :8sM.W1uA;"Qޖ\1^nk!b TqT Q.s-^H>=N|jtGHBμ? 뛗eFyl?l7?s,u79yoD^F6ToxB#dwM2L߃kM߆0hswPv9::ԥBm0P %#@p]ԍ= vC`>X!zQv3rRIFqwaapwWmH[W~$fYkC;ilPGؐ.)!bV35iv RdG"eCJ~8ֵu`%e(a=z`yxrs-rEdaOW((9[rV,u QPrv)M~6q^EG6{RA}"?O'l kqzY:DސzV=@\=Xm>d"O^`ήagn s8No(g%=e5ȫ\GZ{q@UN?8-(iF䱋}Hmr{ l!MXaX}([FD~ Q,ւ&$338Hl>Q9fD߬M!k Y/P4~TAx"y0=d};u(vzv{guN}pZ 熌gJy@ ؼ` {6쪶?FoK$fN52[ ƚm8O[X55[Ր 6>/lpʅ`5|j,5&sf>˯ɿ>)oL.(Z(~x^2VWeT6Y^Z>UP1[YYLWVtujj?.ZT_^{Cwwe~Юp+5t 6=ן8G}X1$%bۖkh a]%))}@t-Qd5=O2!]+umJFJH G≑d$:  #&vLNJc*dt‘{.w-Hwj endstream endobj 18 0 obj [52 0 R] endobj 19 0 obj <>stream H\j0}\v/5ɸj ѽ/[h@cfM2 w;ʆfZYƛ.tusz9К t24Ժ` N]S m*Caas33XY2E5@,eZx?/[Wbsfh2$+EVɊ[e@ZeN~vM\ztSJAϠS d̐3OSz>_qPJ@0p#H`0tљ/O'K% ځp'g^*tk/,ovzBcfF~{MfF\ endstream endobj 52 0 obj <> endobj 53 0 obj <> endobj 54 0 obj <> endobj 55 0 obj <>stream Hj`@ 8&* endstream endobj 56 0 obj <>stream HVol[??=?ININqɿn6vKIڤ]JiWB Ե&$4&m&OSY&}`ИPB>>6γ!(?{Ͻ>߹w l '3]]x-A?yB7-$CGOEpCGN>^_P?ZZ[p~ g7 q޼tĩKW؍#ߚ/usVwĮ~?T^uo]9ۋ~F?!Cd䏌 cLtWaW̭ܛ [52I3ގkçn:(hyܔ@/\%!߫ga8x,fg:ցziyFㄶ-#֮o֝XU_FBןV5,T%R -3pu?kUpuSķ5(WvTjpڵrvmVqp'R|~gV&YhÁeRנ֘"յ5qk׾` E-2axd:Y-חVcaEb:ﶴOVJiĈՔ܎;&{yOr cv \j=wS=uկ{\'}_NcAʃwQB0"m&@Ƞڔ*_54Xv椈D,wYw8\p?TgRW15 89rc]!Z}QD8 910CA+RHbDȒiy iZ(h*I+ o2T?o5Fw0A0ia=Ov$TBVZɇz0E/]<3U^9tlnG͡dJ LL?\ƻsGVN.JҴq7bLD.v@`^Tm"xN]XHgL"z4L!z.2bQ#;yѸa !̱hXC96 d׷fE%MH)Ssc}婑>S<ɰE*N3 y*gܗMZXsjc;O8f&mJԞ\ّܮf;t1PZfuSe7Nbuqo@֨N g6*&=\W *R%Kˢ Ŭ)[|vfRGq{,rW_Es6Mqb;Cv?2;"ۭfGXkS~g4u>{zs$]5m>eIxAAgHkI1XTȡeTA &DFUofQW"DsFhPqqgTi+r2LR%_fh|*wp~ؒI {`-+9Ecj-}jܥ]sՄW^/MvulIN,m}O<;׹`v:q0g?(:ܦUOk#TQ(o4uf~2\ʠ2(AAePPVAePPTAAeP`47%$!y&wTYAiٰF]-٥p*?4/ǛxQ),U3| cm}i4ē%RϱP._D*t=;۳ئv=cc;ޑ)L/ydCQ:} .y#o2&#o2"#o2&#o2&#o2<* c* bG1 t&@j #"v#"N"#C > :n"(zWW׸Pp9sLnz]>]? ^?"1 H.K||# $tb{=#;&#`E+!RSoc%bۢ@,pȐOPԭ}S{Y՗I<쿜WMl&OHI#%JDٲc˖-NJ9qmǵƱS'ْM2-,KYuXaab؆ Ӏ5;H91)yQ'ͱ/fNn SG3LPōw&X$Fu{*<]EXF>x>ńR iwP!KAXfLs¨'Xմ7\)7="6%s#-%Lx:wݰjT:hzݛ5e7vl j+Kqdwkّӎ:*&:}?<=Iv58Tg30lqa2ӝ[*vl FD OXk8\sQ|ikD Ǜ^T#a攼gaY.|\Z[^[ Xoݙ}yS`o0[HR*תIc)Բ#S; dM&CLUcDLYr+Fɀ E!4( ̗R ];6Afr,¢X\\=SV}Y;ɋ7sjMwY5޽'ݹ \L81^< 1+^łhJ)'VoN[V LىB(GƩ !JĂ/l  q6 $Ko UF9kC1.c‰+g?H3ۚE8W j3#a+Rs4C~ʥa^` dv!Ygqچʕâ*((Ur>x W>O-eӊf,߸y+k nnmjްNhV)8{ijEZrXtțk7q S';C_7 (W 엣USF$+ZRԨ錤lh} Dz#tNӨ6}7`\M%. ;E |6/GM@@@@@ 6&P 6V>胯胯胯ru?% >'}t߀T7xdل#i p=zͨwŦ;|li:(AcA0p67=^O)3QaY!׮WM̊8KBmjYEC 39].%uj7\e%]ГT1%DnW#+ohrfɤ/=_ W`M7reH,QMVsruqq |/CL/CL5!? !!_JQ% cEm07D b%oC1Bl( M;phE%T+O z}ge|Q6=['][ݳFzsU;'àa`yE#ix94nUQß6g:7/ھ.u'r٪&yk vz9ŬGbv*j)3` X<9)bε5."VO;r76|5%(izlJVȤcxㆨE\PVtRFRR rck*d YӒϥˉIQb࿡Szj>y;ݙމjBtڭ~xRsƳfvdnȖ!sg`Kn{fVT#,Zo)Xcds0TϢTQ!#i;|ʩËb.IvV^)#o"՘:s痝jQ_6vZ\$U%LbN;|!=7K 5f{xl+^wGEk} <@$!#2U& 9?cƆ =DJX' bncZz~vs덑^/ғOfky]s :A+f^QԉzeiuVOXYy+&sA:A.%`)[na##yTxl> <0Zp,D`4, il?|a3t@G\B)ex0Y'"e]*e+J4kLmuBQVueSYveSV%Q&U&Ѫ]~viD:e|9{=as9,38*c yޠSTU%zil#r̲ͪpQ4D ý_^$F.d(ն*Xc.3/,ڲe!I{6FڲJY?frKq q:͖b\IǢYm[,Xl x"/4TY;V 6݋ r]z7"IP= ?sLlqKc\޸5}+oD{ pvoy^[I᬴$jT_նXmwJ(KKl+W|UuMݾϞbj(rM[`E LymO i%&N#`e3G̜ V}}kxϊ'Lzwk'Pk2+BĄR`v'wrF놾݊_HoGs>> յԜ^ƷVWov1ь13J2U[kX۟K,Y'DQmwvyshB@[U(|C)z]E9T`6zU:_Asd&?⩲_dFZˈݜֿ ֖RO}}Qw\ٹvn;IFߑ/ kW1݇< :JZPxt7V @~U XG~a ‡i`^>/-7&0,@wy@9]6G{9zt_ۦz1O&=/>0Fw> endobj 8 0 obj <>stream H[%K?Pi#Dp}3h0 VdʬEĊ+K?onN3ֶQSs=޿bKk`sQ|_Qp-d_nKususJe͇P=%6KմTvg,yrL[--gv8{RzckS[甝ˤ[_YSmֱK'3 a03;d,LGƺ> Ȝ-6\>e0Ҷww/G 9CУfmЉP G iuƖkcM&bc@M]$<6خ7bZ0Bg 1ѴMTfhh% V5|5>T::a&CzkJa*QMK=٧1>!%VT$:4MK&2Fbb>i|%Oz{r؞KO{m5XLj$OnqXh'`?;}?n;`#!۞>3gXӱ7uTnG=+,9 y{F?xe-ӯ A 5вZB qۉj% qmȃl9^kM| a?֢=c ?j5CxG sOg(y|gAD~`_+&DX]E!y2BMhmxV$cI,kzxW@gPk S4 +vrn.3Df>pŠBo갔&Lwg{ u&_Gd4**r8wۺE>)4CP*nSiBƎ@SP@jC˰6fr"=GEt i,CI&D59qHNrՖxMv!RM< j*=WxXYqgM0z>D>[r<505!U_a:e9C-D_UG,P9Z"gִUǫf Xa~Mb9&OHU)[+Z5d!k3O$Gf{l39\L%]8E@mW(T`NvU:^)Y4T}Сz(A::vc*{c..##CqS_;IƼAuo6}Q+eʻgWb8t]ZnD{tg3oޮ2d;TVZr`[Q d&~e8IG2<[2TlgIes9Uu`$*rdMbhʺuG]POB>焗'ʁ.{>sU+H{/mp 3Rw^IH CSB6(yJJ]^v>*p2U,Z]: %07`YINx~h])$ r;/Q岙P[O 3ԅ$ QUޖSK(Zc)kM<.Iz+AF,?6)Eܠ[vܫ" = rb %:wv)H~l;}+3]iYzéyߏ.o&.u;vOatdl)&pO:= F#==(WUlT]ߺ5M< y"B囫$hb#&VdڛPИ=z5Q&k+e]hzJg?F*d45߃t {Wuc\C9M^ٽp5@ U䒁.kD(VE| +ԗuمEG~/$Z}ttDt)KVPxDFnNۤy$L$RᐘT;Y9b5WԂTDi(ث4:Pn[Jȼ\Y9F,w|q]Q8_102pfc2P0N|VTS"E)r0jy]T󮗧FQҗ"4 Ru:@/bG)1y==u/h-v'K>3I-uH(! cy%kJץUٿYUOS$Ց}& lrhVl{zQR>ZnvZW6lՅ HhH"e+#hmU1ηé+}G^[kFGC/WX;r)UWX#L*)^lyF9@ M09͵v$pRSI,^R?]@C/k3{nx}ۄ;95zeոLIwE7yϗm# nAr(؇r!,@n/YHLeۤ!]˥D\V9Pn ;B/hib"jW_EȀ3 VhB=ʺX4c,5ABEp,TmQC5WKKHȼh3Qq3qY:gRttMCtP#я^)xb˥"n$$ ;Ep&W%zWm$Iߩ ΂⇄TM.sTW%Է:6ڬ&DhR}"8V ϗP )-Fov2w{]vh a'u$YbhP2,0m'ʔ_k; ´- \[?TCTOSBzH@'@إ-QH~`rl?2f +N(AL\T!6 ^nhAd ĔJx[l;D,uU s6UE]d[LٶՓvqpxlhT-"+#P8 BߵIQG*慑^ːC$&袈nş!Fa%vG_|9C]B 6lEf.c-\ʏH:/]f!~պN!z ix4pQT{S_Ep)88]$ĄLSvhc ] g_*L)HCۂW%sjȪ-2Bog-;lWI;p6Ŧ<2 S}nxpydoEVrګcVo{0}q=`8*{Je>R ~zUv?0X?i#W*tBJ vkeLɦ\k6k;kQ_$/0#\58IbmẐfq=9o<?@?cɭXq=B|Ske*v$,hߗ-\܀5U8U z,hn|Ա":Mۨ;t8B 9G[ܕ-͞ ko͠* *kZO.l=&\| vNO0ݏʻVGьr[,*;Q q?eX-4J?PYPf?;D=lc7W3z~Ʉ䳤Bz ˰܆T]UxŌiGcHiTrdAFZJxyܼص2qoq5 Xϥmj&qYsdOCEkep1CݝAWHqqN^q'}Q5etg:/{f-(/tZ&Kd.Dל=w`ځD.20\0XmhH8:Y=icO5PSuO2xE7`OMѳqXW&Z:6 N`Fhr] eYlKF(0]@qP˴iA])Y2>z/sFW_Ot^¬oE)9e` *dDV* GZ7/wHJqW'=߬dyתhQ^XH'րKCA[($XJӢ(iW{+[lYg6 .Y K'5Id'j:r4D!0?wG\^v8>"|C$ۖ=ݟkNmdDT!"C?e׭ s~ɀ7~X2p  nP .<}wU:)ReD%!Mp3%O:3|T{6)ɜ5߿y7e+rܫ׽}N%^>V =NT:m> 1LϤ;"_ 8|ﬣ^B:3^<3 ;uG_9?GGA*BdJԎѬj!uEud+;lddnP$L?`+J0)s>\4mJIJ/ǁaҐ95=')ѳ.YE)qXdؤ6= S?>ev}1QD,u7g~+wE//!}{?uKA'* Uց`TD5 VrǒYyQ U&o_=H}*/X"+& " > qesd4~TYsߨq+*;\0(*ȀVU*'dg_B!j&7Wl#> 4a8##LBw*ʙ4Fi.Btu rj;/n$RF*d <0u y\qL0PfR { ﷈k:8ʟ*eL^*y"0DeJpBtU42R(U#/ oQ nt# 䫟&ֵqU_-(MZVU T-HT%R3APanMs^2݉lWN *Q~,3V[♬& ] b rEw f!g%kf V( @ty01~.B="j)s1:XK3AA%!EVZJH[F5pEtWPET'iÏ'u4 lsܵC}RT|1+4LXE`ÊQb%SM ":C UڶZ4m[]XG]M4ʝoOp'tGS@VI;!M=Co.UeYM`"8OqXA|rScu{ %bB[H '$[Q!c QYrl6}o] ̊ MLGobȼHkmzܭNdzDr_Mi!s sa h%J雈%w4jţ5.N AMOCFC8SwMO_nҊw8(R.`g{?6FFH"9}b<0j+4vuv%Y/ C "ǪSѳ/M,Ų(EU1OD,ٳ6/U !{9=w$(7 Xw)Fo6F"%?ГhZlR7B7ug6,n*8w[;ȺAvKݺg7ejPW/+F)'Ni&nB@{jix}]z:|I)g+CKLrrW82 31O&;!RVC&u-XڋՑTPs(1kdutXxC pgT:{!2/y,5fNz80fƧĪrȎ ʣm eLivMNAHEN`$v3H5u4 F7s clUYY6oiܔjeL&(g' iZk b"+}t[?-^0VdvLi|EBI{r=B:kԠ&ՈFdiXL)GkTP,L:gy,ۉ(WN8fm $?[|^}{1=HDg.jbTӊTUN.#`͌Gj]uxN]`:L#J)aܪ7?AE$?]!~-;Ӛ_ӈg7d){M)FK+E)!.METBý ~[Ei|i8og BXze >\ב !ajo:H%Wؽ7`|؛BT2ITl.M43Os,t5%]Q@gP"S$錶9N~PyP!W&QY*o8oV+dHMzz';NUM) 4 EVK|$л햂Ʉ1cwB.Lc3 yb%(k0ïάT"ݛ;I*t$Y8byس+ߖTWQ|oJAK%Qz] v&CLw=cm~ݺ/(rW/ ࡛:^{n?)>IFLh΋0))M գ!"[:TuNr(%9кKHMrkPV[gG Au /X/tU$m6.OR A ;L)= Xs]L, Nv=Rx)-wRWl$bfYlc uGڽnɦ_J fYl{?Pj~LMŒ,I$WjxHLV<qF[`J2G],6 SHѫ\&E*2.|֟e_b(nXAPէ+)]e+&8TJ˥_ecx5lvj岺рZƋn ^b$z'eS d:ԖrOu$ r5Dh"4}om :|{͏M0t9 !`=e=_gًOhB=y8%Zq|RkMe7u~0E#q_z@dx=;`at~ۆv7ϧ(W= @t5OZz%k\Ȱu'VlǏnxěooʳpJ ojǯgێß3)t}:S~r /*9knrԵCiTu<<[]I v源kΪװ,kf|kjk.U|9-_G'=_O??} "mXY~QDI]^7%Ѫ@6u8ղ?5}>gZ}ǟ?C@K$lc _Z5AP6nUf[Qʥ= ( [*}eU2$Nq> @.glڼ3}rɐq> %{{Gn3U.T3u;xc%~'"x&&Cf,{)&A$Kk (g=zkVBUf5rYM[+i ,r"S%>kh+g U%mn^F#+q߬ŊcVf5VՓ]Fd5[kpՄiP֩{I/2p"??~"ߟ>^z;hO;%q6Ӈu,ϯy `\xs|_BP+~WxV5h [uh+-ANhkjh6V6~ERyOmR[BLh񿁶 m_p_7-tߌn7q 1x"H+qZja[nԼNS/$dfwXYDRvEv_'<'!ώr4=>Q'(mO1^ShoO t=O KK3{z4?P{m\O[Y>m!֮i}7-ꐺqn5k: b>_ٯLe^8 ?L[v?.ṡDyPd>klFPlC_/;`ݦب Ih}/SxaP}zo=ϐ/g\򭢙xrao8 ~UR@?=WLQ"24!cmtJ+ $oohS[9MfbFATC= w2֎aS E,jdjPNK.׎{pZq۟.G#7'RhgtUjJ@CgUrk!Je߼d/'ܺ4TiA-缕N=qeټX*zVF9+C=L 5!I!5,٪)XRLc_ăs.9(Pcl> VK2nQMaae$H|L x*‹'=h݌i)̜KPIհ䜒3t2;}"3U?fS-' [-w\*z{ s)#=s^\#),ƥ|`^L_f'£ڇcgˇYN,-Cp(+öҨ!Ͱ:{.[7.sCuؔ#QELMLF讖u|Z4Um~ {vX|6ͩ^&O\T&+;;lH(| 1a}|Yrmaʐs- IU,fhȘB;+[G] Z9XLuA ϵ?v42LOvZHt]Zr})Z_kvw YxckhKu-,{=j[G͒A!wGO8ܒ2'*?M_u $3]9J .}ی~T x'ǖ8@ȿNq04GRDltgCø̩*m LJTt~p^d3vҋ6V,ޮiAXוUGEU|0Ou%V#-<#njkyg'p yer\**\3MH쭐 2)rRXQ"}U_o*Zr 3S>}]{36VDZ%un['t w;:,\-ײ%;mm5 Sհb3lJKg)a-MIyEí`i8@"q67 &qͅTB D,~%T^x4@ui!(?e(ZLiXlGZ( giqY2]DScr9\D8>G⎮vbn[z0߫+?k5}ِ; SCeRG2$DP MhyL{[f2F?.VWXuR}=t_]+Gy͝E.6kr6#⍖qwJ./MHkVs)n0$J׋zPeZα{=}C丫Z ~db9%x3-9)MV_.iTll6\cEԲf Ѫj^ SlŬ<:~xN/,\ɶYx k5 CklzG$ 7 }Qυ/sIξ_l{kYE6ܧ̏i63rVл(Eg1?EVxyjyjD)q-iaΒxY|f|zw7)R $ ["UƈSҦe$4e8f[\git+:5tmeѩ*RjD(*0HX~ivQy[4sXkuEa KPM[4|ؽ[북h,V<ڶ- r>VB.S:t3ض$Xi'wv^8m:2\>٭ٻoz'л-+'ܳN=md826G,_bra [eͬ.rg ٷSk9T0q%C29rgh`4;V U2C\gwڇʳȤxXoyOqvhT.>?n-//+jrI2/dSeMǵ"tB9hD|VZ42?3fj?r}lqWCWa@i=ᄗkdQ=l$گ~YnAr>K{ܭDjEa jig9˭^}t]3 cJmt5*n4J5ofT3 & -8ۺ@Ff1uw} µa*+1gڰM4N* kAF"mvVLD"U陫eA:}9hTZZXm(+y jԱYL$džYv҄tcA›$v?e'oCkO?gNaVfg>g9a8)4Ǥg1s;%_#\K9h @|wúX6]*X^;,Cp [B391 WF)Š!ٰ~|.6#7 "ǏuAE .,p41$ (f FCmϻ}L5 ]^Tp<<)QZyNu]aYkJ-cm0VB ڽO|nؘ%m.w1s5` Fӳ_{ ;]0K6;w?PlYСW;rWdO$IٖO_F Au`S$zZHt}7 ;(}9&k1r>RYZl&RЈpXwgh„P$C3/Ș83yAwkDyci/`o)( XJNC6[x+M:V%D$P7N,/Li\ѫ)TZHdB3J#7eE2i aNe6KJ &\KthwUh\J%<0șkrYd%1|(^;S{4StvK,$Y(c*vfuӟ6OcP!Ca@U9Q5(ةʆ}C>C:  Cs渦l{?iT)v(D9KdeuMrB/O$9J1bK3՟e:.S+G=;w rQR:E<~tog*N)ŅzMBTs>DR2UmU5.B)3X#]ƻv>n pM#CIJCt"giӬ^!=E"@ro[!C/Fh ůP(},;S֨m^VB@Ͳ=yԾ;6$Ut@ES.Raz~=DN4}w^۟oy򫾇g{E!>%}w }}iAq{gyOd~0F{Kβ Ӎeީ 8}}UZ JSmqiw[V;*3,쌴qiOpsyoEŀQT3%F> ;xC±>IUztC= ŶqB{t31&) $博l0h H Q OI+r\P oP¦.-^i G$":{VnB) ;` 7݌=}#OcOXuiDαXJym>v6X ;ʱ[Xt9n8{*TV9GuXi.V 1/>2;PFb6!vZ`OWgsV:U"b tv ' L/Pi4\)o@߿ex070 k02Z,8VX%W\!5eTrԂ5"PR`yxJ" ,=Ǧ,KDªE,%S+2$"*E< zkDV6-C""ڙΓ#K۝QZ>VE>Z`'B4VV$~4O^i:oW33m1l7кa\Sv%)Vd*+/VWڢ_n֌,[[Y[۬ kv9҄%(|l:#߬pNpA] ?Qs Q9^}R^t5LifeU]g7fՖG,C{`w0Kbwf~*o@F)We|HF.oh[ sK55ȷ*O2PmwlˈUj9΃۩2Qv0(G2бsmZRƛP;)>UIu; .|4zGZ,4-֡y_3jg;F=ԫs9{h\ڌw+RWϬ$L(E9(Ǧ>Jwn7 (*GntUnVȧIZwOڪ:/o㝝R""u7OlѼwkC7&06ޔY (JRìRt\S{_-%eCwovbѧ#fN]i+)VsWD "WF'Sq^4cvH ?F$VwFa4y[:PETQ3*( ͛ڧقw2Bo"V;>Ϋ\:ɇ ]B؅DҧDL EltHhYp4l8ɋ6'i*:2Տ):YL9IXWKYU)Jsۏ Ftak"*w G 3tc$qGΚE  Ԝ2J2w&5.7B&NqU96Me6͆8%o7zN Fu뜡 MK iH5Tt4)}$TWj=vo1Ů槤~E]7ݙ>-Ze*XYz2Ljm-bi|} IdWU Ċ$/*]?"8h?TQSP>׻F2\[#!wVۚҙ t"]qc_[4;Sľx et?"l*#=H -c,]Tq|2t7]VTD;PlQlۓԝ'A3qucpwǩ ڎ"%Ѣ eRpO"}5pD2S ڗe,o*Ъw^PjK}"Gi>OHDoh㋲_8NЩPQbŠ|1L3֐앃` tێu:R6.kFûw6,c/ q4Gl'*<1nmϺIc)̵wIpT->N7Y٦ۏA`fGxߤϷ|=@.'(zM>Q_}9~6콧 4,K#@V$5ln~Eٟf<#S$e$]qOp+KpPAZQ.(Rql$N 2-M٢Y4̟Tj;\4IB6TjlK`pfH ʇR+0"|[PTCtI1i a*L)k3'aYL3 [ +ỬXz $`j\u20qdB[]ubpgR r Pk`|/nYر#>gq\XFek)/!Z=B]WX֌^(_\xS$h Xob护"؆2c=4ɀYf50b@>㐴e hAhhzѠ2d]R ~\SQHW-(pA^rY>sԮB35(H O>O(, uxlL\u4=<}_' QwG weȝ͓BsTOc((Dx6tUP6e.()W8sh8}0un <,x`[=€fjș1ʃ:^8 ܥkbZ\h2d5ܕLr0@.z`|?8 nts6wn/1VNR@E~\w2x۟x S0%4*l҃~ dqqw:E!;UaJػvCǙD+%A=8[)Ln{ȜobrF wNJ-"8U]RKu;Ce CB3)8 T&@2BN9#d .Zf7Yҷ+YDtUvU>jg%9ϡ+ #C;xwMׂf-YpY.v`(l|GH;m^rɬC 3jX!{>"3ТI{ JN)2 5<c3 [|x3Vl;߫GI,)Me1R̦:}Su4N ZWχj%SrE"D">Ŗᴵv\Y&ZKm2E1xՓuP[d#hqh I\g^=>&/B!og_¡fcJglRGz= wb&yfX>&%.Y &yECB K6{8`x!.;dyiOA{$--wT!`{yE9$Gc ɐ碐vaecD>K=9b$\ZvU Q&߇uOƒ܈޿eA#i  La-տe`銟L&[ƱB8s9MQKۙ\%1>nf=StްMÁWWMp@UBt6a4ep DzZ'={pOsJD!;eW(v Ȃ嚉Sx1S r)s(/ba+ݬyoݟFo nKf)ۀ|etvW?hB1_V^ȭDyjO;1j0CmyMJՐ9V%vfyI!6Orͦ9`{-^8,YSmhf ì?zI"WPD[Mk.@(+L7k*W!'yMV=8$吞5|9\?> {tz6P %cK2 Df[0=yǷj߶q~Mko{YB\,2ݐRI LFn؛ AXҔgG3g޴ē.%x. jPr)T뒧[esVo<ٚ[88wX)317* i`@r&Rr/D+ pEetc.X KBpEbA|)1>,o^kIXXM B8S&7 $ٶz -t FS7(ae*<؏sYSlϒʻiYi;:nG [&f-VVj2(Ust VfWlB]ݶ6^ -Yw9Z)xѾk >.X)B6.?&eͱk!1t$RN?I5 P0%Do&U84RLR,#Bf`f cia.S4%dWv(k e#7_Hz0&(wp4HoL:" nM;Mn뻢)UXRZ(]dAY͚YҮF%['.0 qxˆ rE,moB ((!(B.0o:Ï;ӞI\%qAVbeO:SXR"/.&hLd]'lnr -Y)Rsez !q PYM  -gB+8]ЁmCkt_)Qa+'}ڙPx(Ś ,-<ߩ.G wi-Wox{ +D}MhI^݈򘨾jgUa֭UQTvV-J\ j +EuΓ~dFczr}E£2tdhU(si`c h-e?z: Ƹ%KId gNPP5Dd~RLE8W#dW$gbZ=> g2T,?ފz ˎ?cVެȂ#c@U) Wb Ѡ@'v[2}kC:p:L" |U@KӒJǮ) N`lTXD,Sd7ʋ 9g׫髏p;DmR'UˇA+ @{[ )*`BOgjѶ+ll4|nͿU-_ymp$#fg2TS-2[fB0A)dE܁p ҿ>i ɛM&j  *J6.Ց$8w3yR#2^DG1.C' ڸ4kAǕɛ,Pu¨ _3-C\ vdP"C_B?ͯbm7EmA)O[cq!4[}BA8$T㛞4P](Å3?[?߃_ Sͩ)X@:[;0;_zY~xw~q{t{߿rKv"U]*qEoU!w?2y$nߑjd<#CSbmOPp8<H4n%k=ri =@y>IQIUڷq %m `$aq͸eT.Gmy~iST!$:hexX@%J-%6ł7h6pa!lW$"{7U-G-:>aXh *a箆S7ۭ?b~Bh:}i\w!ig).v</vBcrWb2gm݋>9a">Ut\ONC X'f/:ޕhPCZXŒ]s86 JBJ{@|k,F'*{qeIe?txiǣN9tѸM/OVV!L44zzBs4|`B"T {CELMdoeK̺ '$\LJm3Th'q$F ;C]ͨ!aHfV$T|brr3I-buocrhT]}=6:tm{isNw`Iw`=i9|+ggUfb`?c{*$VcQZm"bGh$[bhCH$HlcX@z!P<(:g#b,Pe ym^LWhAL-X)UOiÔex&MO]5+ݎ`n3=p杩2K(%a[R%=;OU!EZ*ࣾѢo~mކi *P9][Mh,$r}"`pn!.#%:[x޽r{4Pw.+q3G~ӄWQÆPIy"2gId,}5\F:B"kL+ paLyOL%鈴6w>>xKKtDCyf@Q*O !HaUQ|b/~'r̴b9PC*_91 =źD3T dll!I$'+7F尴"N! 3jI~wwںRq'ӓTf GIyf<7TGCcCoD(5?>s{Il*y2:n7.?bƎ&BR+-d\Z +p,X,YR֧b`>jPr쪏_#Raet>!/@|:B÷]C7G%-Қew;eoEzFH\ vϟO^uA &J+q`J :Zz997^,ۄmT],ABc=հ$o:Py4,NtjZgdڴz^zlu7Kp^WӶ DBzn`3@!m0 p6rؐSgg{ -='{ HR^pT/7ꆒ|8WȄlDk{|q.ymr**EM8BGP;3~$8>:wQ |ENNCe {$*gltt?=Ӵi;rv5X}o/+tcî1i Rkwݍ.PVrJP^V_%ǒ} Oa n-|nOe,*+ Fa1]?˼+Jt_XYMs Iku ˶!`x%J]S`j @+#'oJ́)gYNwa/9J-DTҰ.҂ >3iޗ^bЈ( vg}ڶGl/`^ѥ\̓8$j/*J`Q0rFj]'!*SAzOs/ek9UǩflhRaOGl%TwkJWc'op{pFK䝚.HVKg؃pBnR>]K}V(Eڢ|s;ώuxmCBҌ3<[z9 s&"=%*?I׽=KIi,:]&m^;&+Rn"zA|Ho(jڞ+Y:쉈s >l32nh9\+*^MqKC_9wD|fIq=0p\N8]vڑ ^" ˘ bQxs$+&K,}[OOz)$άc+ O~y W|^eI@oRi(jE\P&A$YΛ(h,^$cjsNBXá B {[ 6`= fF[A=)^ab3ĝk\z"tt J dR|2c2J0X+cyS*Tq03\8ZH528jo6(7OIW*Ab UpL!P00KDOt\ʆ>7q H4ns)\糯]Yn>~42ޅu7>S9[}'w\$N[~v~oXc'd8rǀcmcN={.M!m+qfB[U${.;Xcs <5$AnQ@_Euut?=1'?@'/"}~%]HH/.!Az|K =t]:)~'z{?}>@ !+sNIj1f,ˈ_vC}(ƼYLYno^mS]zekB眧E=5cj*X R< SyEh7iés.Ii429mS\pu{4Jɧ[P] n:UӅU %,9u]RTM\ y*7ϋv_,4Pu^*qSϹ?<.n<UQQVGsUh keT*:LuC# y}cDv:|\8:}qKͣ͗ǞI2i5](h9%~XLjV]0>Myxd7%/lR! ͸k}T!h!P22 "G^Ӯ;e&_u#]|!(3K-il +hdƔBܳ/C%ڣICu/nzX6mUhXڙ +LhkWRЋ?:$CRQ;Qww 7q l 0ؿ};B.Sm0^~ڥFȪ"QC\Y~~|{y~{Z/w<=c_?܃Ν/>RTm^+i85+8I2eX+9 r^vLbUPx^mdž {;?7!<9l$T{3ݩu!E)B-_$e9mR L#řO^pW /j oͷ*9Kp 6~m_K%?tpCG!^ #qSBpaZ}y30"Lp=nY砇 d  w!=fmpW.歍{ٜO=4 Cr1'עJ63Fo'32VЂAL ye2&4U2X"uv6@-23FZ ftEYiӟmïA,9)`n|栉?3<Y.ǽ;q b&^'k[K lz<8RƷ=hcPI.hkd)#Ep8#Ա͙Tꓢ#yGp#AcfXm&yc!N`ukFVrGEP,hy}ݘo trX|Yjr޳s6ox& V9}Z }!A"ul%iv1zHWe~Y(W Vʅmpq@I@-sչIWwKŒ$d KzW.G?KN ~-Gs;zD ý fQ?D!p'G'i  @S2x@|uܣhO))>'IDJCZxBHT1m 9\@D7<5IjU4ׅ'Wƭjg{:>'igvJݾb[j[-n$fji*B,x\T8tܢg.~>Һyn3<_ bs1f5/&/V퇭Oe>zdZqWTM.JoMp̓~L ̹;f@NN'~ ~$$,/@Bj[e{ڵBړ~@\x;y~)b# jni6Չ~ȷXl\6!%Swr:SH6g ryU/r{JtV>rvV_D?mK|\ܣ$#Hm {cyC:bնFe㎞͆#9RqYdTT'nNVD.3V;G9(m4-x|(cH9 [Lw#ljf wcxO+8W[T~@zM՗vg[e^ǭ8tCSQP5tGz[nX|gB0}|n?m܇ PXc Hi,|؆!I4XOz(x<%PU>6wvSUc:]<ҦڅVГ'.W\'Qu})II1+Z/S1klb⭤mu.XV'p,HF_>jb'K1AkX3:31we̘oʸ wU/ݝ #@jd>2}E~oP Ց{RF|,KS%,8x3C*spݎ:ZZ55 {ǫ_XS+!c%U܋m6koQȎ7"@\+gB=2Wt^\ 1ex p<Ttę/'H8$hea:Bx`lkܸ(CeyTaN? +Yob_oN1f+:cIXg_ m6 jL.O5Fy7?wʺn7QK?6FUgE(K[0q+Nb& ͶЀ i-ՋQUljpm!^y֖IS~Zg\)0,I&$5U|7^)GIxfSTqq$EWՎQaSYP%mt Ky,J~ڻ\ű [kQr8Bt`A)3@TSEUi _2 vAj/5Nḏqy֜&P;Z[, IU8K^xS5e@E6UHV7| ,7 Vd;ޤ-L ykB-LV,4F-o]*[~؏' #L7! u`D12.q4:ƃ+2y+|О+|+6~yJ,ʱKγ%Q7 sr9}ZMlV7A=Zn~ezrxd,R TʽxsTpW&{ޭ~2`;MсpI6lU劧:-ޠ)pg[4DVY{,qQZF׆*h(^}ue/[>yi 28%ϿI"J4}6. 4)b2?谐{{(+NQt&p_ew Yrȍ S%<# ` `/-`gEAIp*OuXQJ4Jݨܔ JUe7nJ:H-f~**֪Ȃ7^-ᵌ>+{M JFS.,Ci(".ݥG6AÚrzZy?pn{', 3Y [2ˆdp n)b67_d_j2y=VA_`,UvF*UPى-seO9ǣoz \KX`Ba׶/˺V!x-,ZyQ*f9[ 555e+$u{LSJ-U &Twh8s}| 79KYxǹa%]F 6v~ wOjRPIԜg@rSUKȤIT.hBs ݈۔?? o|TklD*%*Vb_|:ۗ ڔfuQ_Z0 К?"ommh ރ$L'zdпbit(5i蚾uGPӎxYp,nHH- |uv2F ЧB{PDI(wrzzJ{מ۪hiff$er91Frf`&3V emuHUjCkWˆA `Ӿs(}:n02 ` `0آ+<[*{36ɸൣ;tvѵʛ j|YT'HƬsT(;, -8b0򻽙@g]^:gOY(WwhUOBo*{3"7?۸$k{> ,m^1Ԫ,:Ag^4Nx~G&D^!ٱAnMqȶ_i1v- RQA l<4dkVC|60"&$N +޿dLd'=&Ym `[$nQ ɷ\;Y"*:Vp3D49.?lzAnU"~13woU҇J|!iqy[ < ht56>BDW KƱ.93A+= LCi&!ZY$#).n]o&v酒"`oʈ萁كT&.ܰjT w0-r'_Dk~=VHiTJToL#SϷmz[@cZ1Pc |nD"e KMAq|TUYأע5^hH:TNeut:~9%MrkM}OdTQ]aPՖgR*v/i@H$H0U2$Fߧ닻\U^zHF-Kro^3/y: D&>FP"\<El vpH|H7Z7_> leRlU1JSnp:ٝqr+6%x\5Hٳc;^챩WŽ ֧0=XZѿH>¦ZxLTG>RHo];z8oύJAy4kH3J>zx%VçT4gE*0U'`s$$H46l%b뮂eP; zc>I4`;.V?wǩ\g`G&g+,+򧺟IAiB *` c~Aqd|GT_X۴{M&$@pE+@؏sre$Q+B~p;U9̞dowfc HB4zS?o+aʣ娃0.5IC IU`ۊ7U,ΊJ ')`Mr~z:]QE~,~f~HҞ5bF\ShG?b}eդ5g;3 = J?깻cB`1( VTdsSGe lA׫A$=<[qE VIl ||恜aL{q^wVuWN,lwWyc95u,AOӢ#](%agڠڠ tmS1fK8v.:P2s0QL:) ,VwG=!Qs)'#L^M \/6Fd Er_J, p)޷7չ"WE8Ɏ\@S:r hpdtQIw{5Dp`Ev:>\m%'Ug83uDAYs(ҡs & T^w\Q_sA/VC848^qs2ϥ,]=q <> 6#`%C&g2Eh _"-vk#@*,B{AzР5i8@jB$<;>V23PN(zEpq.^1=-Ϻ+4Jib\S I `}s"V;AcjՈnoL,lL en`eWWrWy3tOy%zC6[0*OÔ47\?mqL+z|"x,~<9G*?EQ#{Ȟ7]%:j$8U w.FRnl yh[`xr;JS%w*N9;\F<{) g@C2n<YLq#tǹQA5>H2qᄲ|ꉲ]ۂoi{Moω;^:Ы/U=ٍdE%曬{>tXBz%X&LMN6KoG2l;6!Kba}hIhqV!Ug^zLVKGtEt3|-I}zyuY~$1 lDz(XMoV%Z *M 8?^;T OK`}Q@^N^ ,B?QPOʦNWV.qj [@'_*)KM>WETǬV- $zR lVb׳}u4XVQǛ<'s\urPϑM`Y"?W?o_Ufy$K(ׯ(}RbaR&FQ H`h=972+zaL fT"E,(LH4|,hEyRIk8^^&YQ50{͘XT觇!<}_>YѬT*m)||˺C(C4{'b_ޤ`I{qD]u+r\Rw.oXᇩГ"J.mSh +{39ɊPtd{ΧguH7Z's%o?UQyANxg7hsgNIueXsux[ YpI7M/Q{QthːbP4W5UDHWs\zqt%BD#F (m*Ѷ ~_:%P(.T9-U Y|$hTT{v%,gDǩi9.#7<"2m!+(/W="jI3IU'oBN[x|;vH~l$LeJRܖHVZ4hdz!!1Px$Ć6JӶA#j|wկ L Ԏf"7L/AQ0`ɸ$3$0քnak_nωE.΅#j;TO *hT)Q!d?6m=tʙz zTLl8[°@kL]wٖ])v- ?W7“ڔ|OEz]xݤE)Vm74)5O$Ρ򰹅vGh/G܋gu 2Y Y(@XKg 5/mI U Rooտp"ıEvf׋\9@T?(ځOwrMlKHKYN\Cc9Kl lAp%+FJy?y$],=% F$e:oTvj-%~?t[kiFӊAG^ ծ1}!6u$|Ǵɶ+xKW6Hh"9[hSGj l[+:#jgV֝(UC}>4MCNvZ8%J3y{.L-EHw9K8n{mU94)o"x))_>[4~-Tv\da5EC.!kY1UE0".&&OK]k1hT7UC.[lJ50:&vfS)Z*$ԛfXneͬ{L[i)Ԭq1UPG(z<>h@dEryRJ>7*"*É)7)0BlHPl~]ckvoa: ^sstD2n߲0i*᷸2rj8Y|MBF<SB:Tlwjdd$igVxdOb[[wx#rp<ƭ~ PeFYZz˷ftN{u׈s !&$[Vj7>%8-44 rGpry+] *KdW"/VeCLߨ옋@uablsb` t@POCvO8.u,+p}<ߩ׿{~~y-T:K#8UPx翟My--VsBj?)SZ?Rq"?/;0;GU3\W]89&"^8F8l*.|ؤcSԂOqRz:Ŗ'y_RR?;xP#ו8] L20EbU6ҽ☭J滨!$־ՅѧS>A\FgjuSDSJ1 f #Db:q5jĵR9M-ؙ?{VtK<<Qdv(ocH$|P-HTOZcdW{&/DqtUȳaDbadhbEIȸ ?>+A}b\K\Bv{ !*jA<5H1 %% TH3ERN%#8S[~UD;}M&hjTpׂ-pK`@5M+ǂީs9+ךЁ=TMqAX.~ml p3#"* u֕М0Vu$V 7PhTAIJ6EgIHFSJL{4ѨB(gq> 8/Jr$uL *j!-zog Im] >ؐhH &T5ÏV_Ӧprȣ[ļ9q]& 96Юjߤ۫?{W62E9%:'Ҷz'"` ބe۰c}]]p .yM)N;ƣ: hq(δ0\"J2.6""xn\5`p|^q&a2(}TA3!۟EnJt]r̡~KҭB',wPlR~͂;3"^VB2k_Tr+ 2bbE9I7 02𭃔&4dв&A3HϤaG7$qAۅiIѕܧ`pF@s_*hEN! cM9w bUݤt̾j^ WTRśo j~d3)ԑWX?Z#HJf4/9m2@ibmNs4wB5,2m(˒w_U}SUzx\(Ţw׮BG_RM{785{Zڊm nw=g|sUbO%,Su}8x,s \tq:~ij7l<倪Y "O,,`!5Oy TZ^iI ՛6n_V wjzgs|gPˢ Ie4mlYl.O,t=PRbJ79g<5=?K7F jDG c ɐ a=(1,,f/vZmﵵH%uO=ߥz7rl7^;U\,{Jyhĸ=/K *U hgAA`x˿hd/ %Hbs2 /~NeŻyi31|Ѧ~nCb/ ZuIX79 Nr%~Q2ȯ74>S5<|ժHcJ#KCS%θ϶yE82a!޷[VL&F@ +5ܴ6oi}b#$rg{N iK֣HNcX;ZX)zv fDbW[ yZ,,%Wq~(Òu$d0,\.i\VՖukAvjHZJF]f^q/<(v$4 .> z^|^4r(s /s4$NxÄ u,8cZC4l-&<ÕG[z~Nuf#;,ge-rַʱ2گ{`sE0L:靝3~ݺ{B[FeuŒUhkfP vE9O8o B$*i3y ĭˣr&7}:1AO4VfY sR_ե]🼘SL,U_t"w47Nk|H{WlyP,n1of,}e'Ѹ 깝p\s,!sӎdJT@iUc2 4H_ffGwDN|iif-.mœNŪ~ʒ"_ʬZ,؍B,@# CFDg0 jgVdD:>$a&9R&tzգ&Zu4m| i$Kk4#7V, &AY x6̚h)hA烚F$ m8Q^09ekU{;Iݶl|tlV 2"v!ݧ MC [=e,'PߘzN7Fؐ8c:Q*PcU@ԧ?mېI@eLb<+.9s)j{#!L/C]NކpXV{֎}܉.~m/-ō*6 vڰKnLLuJoC}+r?Y̋5\a޾F}&e,;~YHok78%3 F^ ݉SCnSѱm^w$&5s-,G|42HS < 9>ivQg /oj c2*Dqm*b+":yקNr`Ū΅ ]>Tf'3/NA=V&$YXwlLZjm5ZQFWQd$ ⮈tBk5̆]VA h,ʘ^nĒ Bc]ؑ]%'Qu&NE˥#An\"su?HjLze zq/Yp=핃du& %5(eNn'4\ьARnu{L0Qe%IZ)V,%VTBɦڡ;|"h؈)5T3c -3K؃сo?eq%SN=!}%//gF`B|'S_=@o҄P߄Yk#|>)T|?M~Q Oa-9F9?7'_N/Z\ݽyU;ME2wrDDF6=U_5UVh (~Uʦ T,3 PŁd;*^ᩐ!ڙZAw|J̌Q[W&pYve\S.مUczivj%0Ѽ*yZOk=ʝo (@<ʅd7Qn(oEGn|rv|(/P>`>~\~M7|mJXFvsd^z'gb %Tvl\,]U.p+]:2?j"n2 M[㺧H1)w+Nz"=4 [%u6"x+zzV;i#{(ߜRU_t_jOBM]MPĪ髓\pl7 PRD\@);56vTud/!bѽk&d]NCkh2XdjJh`FMG 5v]52(MqȺe.4SХP#o( `O D_  ۯ><~Y?:\*̓CJ <hm[[ȟlm`RvSNrH{~ڧiaݒyex?R6c-5q{k1qCBf`$VNj:om96/F6/ګe7+T`MXG0և$Xn<{T,|DFFǿ&*=_Cz,W]?1Ʋَ;^L%!M|:L@({t27/8݂H-NM>&æԾ L pum>K0O18|ǒTѵ@iy äǶ*s [k[]WLPʴ;Uz|ε\_kƓR(ˌ~dOn!\9wI]WNR$Ӧi~dR,87etCɃGν/0q=vwG51xu>!PJOKs)877ſBoZyXص=j} kTr!IC^,]}\aOm ᩹kēKkNx3{뜫P!+"2{DRo.vcI!D:iX`U8p8ia+/Xm}.+1KX 1ǝ>H wk~߇3m$3Yf79fT.@5KۥVx_?pK]0p9 T42w ܜК"y=,Ji_^ j#+.⦷_Y=-qdd1ĩ45GsEUēȭ: ,vg ͣ#=2LwS[W艃P-;`d{ .u?=tŭ?CɇX崰t2eַz*כwmrەb-3I4P2iI o.Ϛ(-X-P@sU4 M$ѫMTplҼj ߏu *3{n_#ƻ{f?G6;4ՄM~&c;)n7vp{07>#r0M@5.u+^=cԪ5zm|s"m1?vgeֆ]Q]!n|e@) cur?z>v=׿ݓq#ȹ9~KJQX\I !~39T:La񟮭KkSESS!"[ψݮDi|l]B.>z[: ͜gHWF"Si>$v݇t(0KB|(~e)J ˢ Lԍ{ fМ!Zٰz 0%0)EvyH(ȤyPGC~Ō$;qj@$G.]qh!)`Bt7 YdkVxGt$qCP5+2E]R+ȢuB.uA ZaA>j,xFr3ޫ]pn+}8֎LGD=v8lE.5y\FQ*`"L2: _ NNN9&bA^'!)r;tc,~#e.3G|0[Xmf88ǁ"bjMI,F{E*ީz:cD˕'9&#(1H5V-&#ErS->=^O ̚Oc-G"AA2SH?NjtϋVE8k>A ڌp}꽙KW*Y1)GB-h:gs j>32u~V%m "_X JI}M<[RhQC"8JXoVP?1wfd\g^V1PpaȀP~b F ̀+.+6l+,+2f.HCXXSD p2%-xA#sn}B#qN&H.f`}O.SЋQb+JQ_* zk!RdRSK>QBbPhPD3|Q_ÇN*]A1? 5QTH‘@,KӅpv Y.PmB kμ&SVoAߵh 3FAdf_=!M$'R0e ie#5 {b~ "n[BH,\8!a%u{^ug "gƉiWWWa;DHͣ!=Dx7u$] P/PC"$Y:%Y{9¯$Bڂu(F7\eZ;VKʇ5Hto4p N]YZ2=ohŢO5@MU۩ @s=>$&Wt6d yN@k^0Cά&pk~ˌ0{\NLD4bt9r,& p8t\Unb,"*-JQz>n̈3a22QJ8l x|el@!(7 "?G74 HHPXaHوKXg@N9U`tLIu8FH dR`ڥg)*r<40DS8rm{?.EĴBḏHZ .E^L. vYS7 +[_2_벫,p/$ r}ZsQƥv5+V9F|_cX_Z}*m돥gIJQf=#np??2˘,sgsn`§"R$%-}r:'E195?WmF 0Y1 endstream endobj 6 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 58 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000067855 00000 n 0000000000 00000 f 0000067912 00000 n 0000232347 00000 n 0000068286 00000 n 0000178073 00000 n 0000177961 00000 n 0000129137 00000 n 0000129406 00000 n 0000129539 00000 n 0000129274 00000 n 0000129674 00000 n 0000129813 00000 n 0000130059 00000 n 0000068661 00000 n 0000170374 00000 n 0000170399 00000 n 0000155039 00000 n 0000155064 00000 n 0000151126 00000 n 0000151151 00000 n 0000147715 00000 n 0000147740 00000 n 0000140697 00000 n 0000140722 00000 n 0000137733 00000 n 0000130290 00000 n 0000130565 00000 n 0000138038 00000 n 0000141268 00000 n 0000141764 00000 n 0000141833 00000 n 0000142151 00000 n 0000142257 00000 n 0000148068 00000 n 0000148268 00000 n 0000148337 00000 n 0000148651 00000 n 0000148738 00000 n 0000151498 00000 n 0000151724 00000 n 0000151793 00000 n 0000152097 00000 n 0000152188 00000 n 0000155821 00000 n 0000156499 00000 n 0000156568 00000 n 0000156869 00000 n 0000156981 00000 n 0000170812 00000 n 0000171126 00000 n 0000171195 00000 n 0000171517 00000 n 0000171613 00000 n 0000886756 00000 n trailer <]>> startxref 887019 %%EOF